Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U577358, SGN-U578438, SGN-U579638, SGN-U580869, SGN-U581429, SGN-U590550, SGN-U590702, SGN-U591038, SGN-U591361, SGN-U591922, and SGN-U593051 in the current build, Tomato 200607 #2
Unigene SGN-U155534

Unigene Basic Information 
Unigene ID: SGN-U155534
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 155534
mRNA sequence: Length: 1093 bp

>SGN-U155534 Lycopersicon Combined #2 (952 members)
TTTCACCATAAGTACTTTTTTTTTTTAAAGAAGGTTCAAGCACCAAACCTCTCACAAGATGAACAGTACATATATGGGCTCAAATCTCAA
TAGGAAAGAAAAGCTTGTTACTACTAGCATAAAGTTTCAAAATTTGAATCTCAAAAAGGAATATCAATGAAGACTAAAATTCAGCAAAAG
CAGATATGCCTTGACATCATTTCTAGATGTAAACATCAAAATAGAAACACTCAAGTTCACATTCCGGTAAAAGCTTTTTTCCCAACACCA
CCAGAACCGGCTGGAATCACCTTCAATACATTGAACCTCACAGTTCAAGATAAGCACTTGGTTTTCAGCAATGGCTTCTTCAGTAATGTC
CTCAGCAGCTGTTGCCACCCGCGGCAATGGTGCACAAGCTAGCATGGTTGCACCCTTCACTGGACTCAAGTCCACCGCTTCTTTCCCTGT
TTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAA
GAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCC
TTGCTTGGAATTCGAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCAGATACTGGACCATGTG
GAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAGGCATGGGTCCG
TATCATCGGATTCGACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAAACTAAT
TGCCCTATGTTTATAGGGACAGTTTGTTTGAATTCTCCTTTGGGTTTTCCCTTGAGAAATTGTATTCATTTTCCCTTGTTTTCCATCTTT
TTATTCCGTGTATGATTAATTCGAATTTCAATCAAGTTTACAAGAACTATATTAATGATAAAAAAAATCTTTACTAAAAAAAAAAAAAAA
AAAAAAAAATCGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (952)  
Alignment image suppressed for unigene with 952 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (53)  
Annotations (manual: 5 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None