This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been split into SGN-U579181, SGN-U579213, SGN-U580290, SGN-U581203, and SGN-U591359 in the current build, Tomato 200607 #2
Unigene SGN-U155597

Unigene Basic Information 
Unigene ID: SGN-U155597
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 155597
mRNA sequence: Length: 1556 bp

>SGN-U155597 Lycopersicon Combined #2 (248 members)
TTTTTTTTTTTTTGCTCTTCTGATGAAATATGCTGTTGATTAAAGCATGAATTATCTTGTAAGATGATCAGTGGACAATAATAATCCTGT
TGGGGGGACAATACGTATAGAGGCTCTACATATACAACATATATTAATGTGACTGAAACATCTTATTGTAAATACAGTTCAAACTAAACA
GTTCCTATCCCCTCTTGTAGGGGAAAAAAAACAAATTCTCAAACCTCTCAGTTACTAATCTGCCATTAAGCAAATTTATCTCTGTTGTGC
ACGGTGCATTCACAGTGCAAAAACTGCAGCTTCCACCTTTCTACAACTTGAGTTTGGTAACATCAATTTTCCTGGGAGGATAAGTATATG
CCTCATAGTTTATTACTTGTCCCAAACTGCTTAATTTTGTAACAGTAGTAATCAAGTCAACCTCATAATCAGTTCGAGACACTGTTTCCC
TGCTCCTTTGGTACTTCTGAATCCAAGGAAGAACTTCTGGATCACTGGCGAGTAGGGCCTCAAAACACAATTCATTTCTTTTTATTTATT
AAAATTAAACCATGGCTGCTTCTACAATGGCTCTTTCCTCCTCTACCTTCGCCGGAAAGACGGTGAAACTCGCACCATCTTCTTCTGAAA
TCAGTGGAAATGGGAGAATTACAATGAGGAAGACTGCTGCCAAGCCCAAGCCAGCTTCCTCTGGTAGCCCATGGTATGGTCCTGACCGTG
TTAAGTACTTGGGCCCATTCTCCGGGGAAGCCCCAAGCTATTTGACTGGTGAGTTCCCTGGTGATTACGGATGGGACACTGCTGGGCTTT
CAGCTGACCCTGAAACATTCGCTAAGAATCGTGAGTTGGAGGTTATTCATTGCAGATGGGCCATGCTTGGTGCTCTTGGATGTGTTTTCC
CCGAGCTTTTGGCACGTAACGGTGTTAAGTTTGGTGAAGCTGTATGGTTCAAAGCTGGATCTCAAATTTTCAGCGAGGGCGGACTTGACT
ACTTGGGAAACCCTAGTTTGGTTCATGCACAAAGCATTTTGGCTATTTGGGCTTGCCAAGTTGTGTTGATGGGAGCCGTTGAGGGTTACC
GTATTGCTGGTGGGCCTCTTGGTGAGGTTGTTGATCCACTTTACCCTGGTGGTAGCTTTGACCCATTGGGCCTTGCTGAAGACCCAGAGG
CTTTTGCTGAGCTCAAGGTGAAGGAGATCAAGAATGGTAGACTTGCTATGTTCTCCATGTTTGGATTCTTTGTTCAAGCTATTGTCACCG
GAAAGGGTCCGTTGGAGAACCTTGCCGACCACATTGCTGACCCAGTTAACAACAACGCCTGGGCTTTTGCCACAAACTTTGTTCCCGGAA
AGTGAGTGCAACAAACTGTTCTCCAATTAGTGTGAGATTATGAGTTTTTAGCTTTGTGAGAGATGAATCTGTAGAAGGGGTCAGTTTTTT
AAAGCATTCTGGGTTATGGGTTCAGTACAAGATTATTGTAAATTGGTTTGGATTAATTAATGAATCTTTTCATCTTGCAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (16)  
mRNA member sequences (248)  
Alignment image suppressed for unigene with 248 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (4)  
Annotations (manual: 2 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None