Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U592016 in the current build, Tomato 200607 #2
Unigene SGN-U160560

Unigene Basic Information 
Unigene ID: SGN-U160560
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 160560
mRNA sequence: Length: 632 bp

>SGN-U160560 Lycopersicon Combined #2 (1 members)
GCATCACAATATATTTGCATTTCTGAAGATTTCAGTTACACAAATGGTAGTACTTCCAATGAATTGAAACATAAATCTAAGCTCCAGGAA
CAAACTTAGTGGCGTAAACCCAAGCATTGTTAGCCACAGGGTTGCCAAGGGGATCTAATAGGTTTTCAAGAGGGCCTTTACCGGTAACAA
TAGCTCGAACGAAGAATCCAAACATGGAGAACATAGCTAGTCTTCCGTTTTTGATTTCCTTTACCTTGAGTTCAGCAAATGTGGTAGGGT
CATCCGCAAGGCCGAGTGGGTCAAAATATTGGCCACCGGGGTATAAGTCGTTGCCTTCTCCAACGCCTGGAAGTACGATGATTCTGAAAC
CTTCAACAAGTCCCATAAGCACCAAGCATTGTCCATCTTCCATGGATAACCTGAAGAGCTCTGTTCTTGGCAAAGGCCTCGGGATCAGCG
GATAAACCAGCAGTGTCCCATACGTAGTCACCAGGGAACTCTCCGTTCAAGTAAGAAGGAGTTTGAGCAGAAAAGGGTCCCAAGTACTTA
ACACGGTCAGGTCCGTACCACAAATCATTACTCATGGTGAATCTGGCAGAGCCCATGGCAACAACATCTCTAAGAGGGTTAGCATTTTTG
GT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E340788
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None