Notice: The contact form functionality has been restored. Apologies for any inconvenience.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U593125 in the current build, Tomato 200607 #2
Unigene SGN-U163781

Unigene Basic Information 
Unigene ID: SGN-U163781
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 163781
mRNA sequence: Length: 562 bp

>SGN-U163781 Lycopersicon Combined #2 (1 members)
CTTCTTCCCATCACCATCTTCTTCTATTTTTCACAAGCAATTTCTTTGCTGGAACAAATTGTTCTTTGTCTCTGTGAAATTAATCTCTCT
TTGTTGTAAAAATGGCTTTGACTTTCACTTCTTCATCTGCAATTCATGGCTCTTTGTCTTCTTCATCTTCTTCTTATGAACAACCCAAAC
TATCCCAATGGCTGAAAGGTACTAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACTGTTTCAAGGAATCAAAACCTTGACATTACCTC
CATTGCTAGCAACGGTGGAAAAGTCAGTTGCATGCAGGTGTGGCCACCAATTAACATGAAGAAGTACAAGACTCTGTCGTACCTTCCTGA
TTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCTATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCGAGACTGATCACGGATT
TGTTGTACCGTGAAAACCATATCTCACCAAAAAACTACAATGGCACATACTGTACCATGTGAAAGTTGCCCATGTTTTGGGTGCACTGAT
GCAACCCATGTCTTGGCTGAGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E391081
[Show Image]
Markers Information (0)  
Expression Data (1)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None