Notice: SGN will be briefly unavailable for maintenance. Apologies.


This unigene is from an out-of-date build, Lycopersicon Combined #2
It has been superseded by SGN-U574746 in the current build, Tomato 200607 #2
Unigene SGN-U170141

Unigene Basic Information 
Unigene ID: SGN-U170141
Unigene Build: Lycopersicon Combined #2
Date: 2003-08-20
Organism: S.lycopersicum
S.habrochaites
S.pennellii
Alternative ID: 170141
mRNA sequence: Length: 769 bp

>SGN-U170141 Lycopersicon Combined #2 (1 members)
CTAAACCCCTAAACCCCAAAATCTGAAACCCTAACAGCCATGGCAGCACTTCGCAGCAAGCTCCGATTTATCACCTCTCAGCATCACCAC
CACCTCCGCCGTTACTCCGCCGCCTCTATCCTTAATCCCGATTCTAAATCTCCACTCTCAGGCAAAGACAAGTCACGCGCCGCCCTAACT
CTCCTCAAATCCGAAACCGACCCACAGCGGATCCTCGACATCTGCCGTGCAGCTGCCTTAACCCCTGAATCCCATCTCGATCGCATTGCA
TATTCCAAAGCCATTTCCAAGCTCAAAGATCTCAATCATTTCTCCGGTATCCGTTCATTTCTCCAGGAATCAACGACCCGGCCTGATTTG
AAATCCGAGCGGTTCATTTCCCATTTCATTGTTCTTTACGGTCAGGCCGGACTGCTTGATGAGGCTAAGAGGACTTTTGAGGAGATGGAG
AAAATGGGCATTCAACGTACTGAGAGAACTCTGAATGCGTTGTTGTTTGCTTGTGTTTTAGCTAAGAATTATGCTGAAATGAAAAGGGTA
TTCGTCGAATACCCAAAAAAGTATGGGTTTGTTCCTAACTTAGATACCTACAATGTGGTGATCAAAGGGTTCTGTGAATCAGGTTCTGCT
AGTTCAGTTTATTCGATATTGGATGAAATGAAAAGAAACAATGTTAAGCCGAATGCAGAGTCTTTTGGGAATTGTATATCCGGGTTTTAT
AAGGAGGAGAAGTATGAAGATGTTGGGAAAATGGTGGAAATGATGAGGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E261795
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None