This unigene is from an out-of-date build, Solanum tuberosum #2
It has been split into SGN-U268399, SGN-U268405, SGN-U268407, and SGN-U268408 in the current build, Solanum tuberosum #4
Unigene SGN-U174190

Unigene Basic Information 
Unigene ID: SGN-U174190
Unigene Build: Solanum tuberosum #2
Date: 2003-12-04
Organism: S.tuberosum
Alternative ID: 174190
mRNA sequence: Length: 532 bp

>SGN-U174190 Solanum tuberosum #2 (11 members)
CTACTCTTTACAACTAAAAGAATATGGAGTCAAAGTTTGCTCACATCATTGTTTTCTTTCTTCTTGCAACTTCCTTTGAAACTCTCTTGG
CACGAAAAGAAAGTGATGGACCAGAAGTCATAGAACTTCAAAAGGAATTTGAATGCAATGGAAAACAAAGGTGGCCAGAACTTATTGGTG
TACCAACAAAGCTTGCTAAGGGGATAATTGAGAAGGAAAATTCACTCATAACTAATGTTCAGATACTACTGAATGGTTCTCCAGTCACAA
TGGATTATCGTTGTAATCGAGTTCGTCTTTTTGATAACATTTTGGGTGATGTTGTACAAATTCCTAGGGTGGCTTAATTAATGGATTATT
ATTGAAGTAATTAAGCAGCCACATGTCAAAAATAATTAGGGTTCATGTATGTTGATTATAATATCTCCATGTACTCTTACTATATATAAT
GAAATAAATAAGTGTGGCTTAATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (11)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None