This unigene is from an out-of-date build, Solanum tuberosum #2
It has been superseded by SGN-U272047 in the current build, Solanum tuberosum #4
Unigene SGN-U175481

Unigene Basic Information 
Unigene ID: SGN-U175481
Unigene Build: Solanum tuberosum #2
Date: 2003-12-04
Organism: S.tuberosum
Alternative ID: 175481
mRNA sequence: Length: 1227 bp

>SGN-U175481 Solanum tuberosum #2 (11 members)
GGAGACAGTTATTGAGGGAATGGGAGAATTACATCTTGAGATCATTGTAGATCGACTGAAAAGGGAATTTAAGGTGGAAGCTAATGTTGG
AGCTCCACAAGTAAACTACCGTGAGAGCATTTCCAGGAACGCAGAAGTGAAATACGTGCACAAGAAGCAGTCTGGTGGTTCAGGACAGTT
TGCTGATATCACAGTAAGGTTTGAACCCATGGAAGCAGGCGGTGGATATGAATTCAAGAGTGAAATCAAGGGAGGTGCAGTGCCAAAAGA
ATATATTCCAGGTGTTATGAAGGGATTAGAAGAATGCATGAGTAACGGGGTACTGGCAGGCTTTCCCGTTGTTGATGTTCGTGCTGTGCT
AGTAGATGGCTCTTACCATGATGTGGATTCAAGTGTTTTGGCATTCCAGCTGGCTGCTCGGGGAGCTTTTAGGGAAGGGATGAGAAAAGC
TAGTCCACAATTGCTAGAACCCATAATGAAGGTTGAAGTAGTAACACCAGAAGAACATCTAGGAGATGTGATTGGTGACCTTAATTCAAG
GAGAGGTCAGATCAACAGCTTTGGAGACAAACCGGGAGGTCTCAAGGTGGTGGATGCTTTAGTTCCATTAGCAGAGATGTTCAATTACGT
TAGTACCTTGCGAGGGATGACAAAGGGTCGTGCATCTTACGTTATGCAATTAGCCAAATTTGACGTTGTCCCTCAACACATTCAAAACCA
GCTTGCCAAAAAGGAGGAAGCAGCAGCCGCTTAGTCAGTCATCTTCCAGATTTTGGATCCACGAACTTGAAAATAGGTATTTTTACTCGA
CAAAGATGTTAAGGCTTGCACAACATTCTTTTTGTACGTACTAGCATGAAACACCGATGGAGAATAGCTGATATTTAGTTATACGTCTGA
GTTTTTTCAGCCATTTGTGTATGTCGTTGAATTTATAAGCTGAGACTCCGAAGGGACAGAAGAAAGAAAGGACTAAATGTGTATACATGC
ATTTAAGATATCTCTGCATCCAAAGAAGCATCAATATTTTAGGGCAAGATTGAGTGTGTCCTGATTTTGGGATTATTTTTCTTACTATAG
AAGAAACAAATATATGCTTTGTAACAATTTGATGCTCTTTATTGAGATCTTAGGTGTAACATCTGACGGTTTGAGTTGTTTATTTCACAT
TTGTTTTATGTTGCAAAAAAAAATATAATATTGAGGTCCAAACTAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (4)  
mRNA member sequences (11)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None