This unigene is from an out-of-date build, Solanum tuberosum #2
It has been superseded by SGN-U276734 in the current build, Solanum tuberosum #4
Unigene SGN-U180637

Unigene Basic Information 
Unigene ID: SGN-U180637
Unigene Build: Solanum tuberosum #2
Date: 2003-12-04
Organism: S.tuberosum
Alternative ID: 180637
mRNA sequence: Length: 793 bp

>SGN-U180637 Solanum tuberosum #2 (4 members)
CAGGGGCATAACATGACGGTTGTTGAGGCAGATGGTCACTATGTGGAGCCATTTGTGGTAAAAAATCTTTTCATTTATTCTGGAGAAACA
TACTCAGTCCTAATTAAAGCTGATCAAGACCCTACAAGAAATTATTGGGCTAGTACAAAAGTTGTCAGCAGGAATAGTACTACTCCAAAT
GGTTTGGGTATTTTCAATTATTACCCAAACCATCCTAGGAGATATCCTCCTACTATACCACCCCCGGGACCACATTGGGATGACGTTGCC
CCCAGGATGGCTCAGAGTGTTGCGATCAAGTCCCACAAAGATTTCATCCATGCCCCTCCTCTGACATCGGACAGGGTCATTGTCATGCTC
AACACACAAAACAGGGTGAACGAGTATGTACGTTGGTCAGTCAACAACGTCTCGTTCAACATGCCTCATACGCCTTACCTGATCGCCCTT
AAGCACAACTTATTACATACTTTCGAGCAAACCCCTCCTCCGGACAACTATGACCAAAAGAATTATGACATATTCAATAAGGCGCCCAAT
GTGAATGCTACAACTAGCAACTCGATTTATCGATTGAAGTTCAACACAACAGTGGACATCATATTGCAAAATGCCAACACAATGAATCTA
AACAACAGTGAGACACATCCTTGGCATTTACATGGACATGACTTTTGGGTCATGGGCTATGGTAATGGAAAGTTCAACCAATCTATTGAC
CCCAAGATTACACTTTGTGAACCCATAATGAAAAACACATCCAGTCATCCTTATGGATGGACGCATTGCGATT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (0)  
Gene Family (0)None
Preceding Unigenes (0)None