This unigene is from an out-of-date build,
Solanum tuberosum #2
It has been superseded by SGN-U273050 in the current build, Solanum tuberosum #4
It has been superseded by SGN-U273050 in the current build, Solanum tuberosum #4
Unigene Basic Information |
Unigene ID: | SGN-U195544 |
Unigene Build: | Solanum tuberosum #2 |
Date: | 2003-12-04 |
Organism: | S.tuberosum |
Alternative ID: | 195544 |
mRNA sequence: | Length: 160 bp |
>SGN-U195544 Solanum tuberosum #2 (1 members)
TAAACAAGTAAACATGTCAATGATTGGATCAAAGTATCTTACTGGCTCATGTGTGTTATTTTGAAGTCTATGATCTCATACTCATTGAAC
TACCACATTGTGAGAATGAATTACAAAGGGTGAATTGTTTATAGCGCTTAGATTGACCAAAAAAAAAAAA
[Blast] [AA Translation]
Associated Loci (0) |
Genomic locations (0) |
![]() |
![]() |
[Show Image]
![]() |
![]() |
![]() |
![]() |
Gene Family (0) |
Preceding Unigenes (0) |