Unigene SGN-U196021

Unigene Basic Information 
Unigene ID: SGN-U196021
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196021
mRNA sequence: Length: 858 bp

>SGN-U196021 Capsicum annuum #1 (30 members)
CCCAAACAAAGTAGACAGCTCCAGGGAGGACGAGAACGAGAACGAGATCTCTGCTTCTTCATTTCTCTCCTCTTTCTCTGCAAGATTCAA
AGATGGGGCTGTCTTTTGGCAAGCTTTTCAGTCGGCTTTTTGCCAAGAAGGAGATGCGCATACTGATGGTGGGTCTTGATGCTGCTGGTA
AAACAACCATTTTGTACAAACTCAAACTTGGAGAGATAGTCACCACCATTCCTACCATTGGTTTCAATGTGGAGACCGTGGAATATAAGA
ACATTAGCTTTACAGTTTGGGATGTTGGGGGTCAAGATAAGATTCGTCCTTTGTGGAGACACTACTTCCAAAATACCCAGGGGCTCATCT
TTGTTGTTGATAGCAATGACAGAGATCGTGTTGTTGAAGCTAGGGATGAGCTTCACAGGATGTTGAATGAGGATGAATTGAGGGATGCTG
TTCTGCTAGTGTTTGCTAACAAGCAAGATCTTCCAAATGCTATGAATGCAGCAGAGATAACTGACAAGCTTGGACTCCATTCTCTCCGCC
AGCGTCACTGGTACATTCAGAGCACTTGTGCAACTTCTGGTGAAGGTCTGTATGAAGGGCTTGATTGGCTGTCAAACAACATAGCAAATA
AGGCATAGAGGCTTAATCATCTTTGGACTCTGGATTATGGAGTAGTGAACCCAGAGAGAATAGGCTTTGTCAATTACTTGTAAACGGTTT
ATTTGTTATCTTTCTTTTGTCCAATGTTTTGTTTCTCAAGGATTCCTTACTGTCTTCTGCAGTGTCAAAATAATTTTTGAATTTAATCAT
CTTAGTGGTTAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AF108891 ADP-ribosylation factorADP-ribosylation factor
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (30)  
Alignment image suppressed for unigene with 30 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 7 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None