Unigene SGN-U196028

Unigene Basic Information 
Unigene ID: SGN-U196028
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196028
mRNA sequence: Length: 1009 bp

>SGN-U196028 Capsicum annuum #1 (31 members)
CCAGTGCTTGTGCTCTGCTCGTGCGTCTTACGGTTTAACGTTTTGCTTAACTCCTCGATATCTTCTTCTTCAGAGCAATTACTATGGGCA
AGTGCTATCCCACTGTGAGCGAGGAGTACCTCAAGGCTGTTGACAAATGTAAAAGGAAACTCAGAGGACTCATTGCTGAGAAGAATTGTG
CTCCTCTTATGCTCCGTCTTGCATGGCACTCTGCTGGTACCTATGATGTGTGCTCCAAAACTGGAGGTCCTTTTGGTACCATGAGGTTCA
AAACTGAGCAGTCTCACGGAGCAAACAATGGTATTGACATTGCTCTCAGGCTCTTGGAGCCCATTAGGGAGCAGTTTCCCATCCTCTCCT
ATGCTGATTTCTATCAATTGGCTGGTGTTGTTGCTGTTGAGGTGACTGGAGGACCTGATGTTCCCTTTCACCCCGGCAGAGAGGACAAGC
CAGAGCCACCTGTTGAAGGTCGCTTGCCTGATGCAACCAAGGGCTCTGACCACTTGAGGGACGTGTTCGTGAAACAAATGGGTCTTTCTG
ATCAGGATATTGTTGCACTCTCTGGTGGCCATACCTTGGGAAGATGCCACAAGGAGCGTTCTGGTTTTGAGGGACCTTGGACCGCCAATC
CCCTCATTTTTGACAACTCATACTTCAAGGAACTATTGGGTGGGGAAAAAGAAGGTCTTTTACAGTTGCCCTCAGACAAGGCTCTCCTCT
CTGATCCTGCTTTCCGTCCCCTTGTTGAGAAATATGCTGCAGATGAAGATGCCTTCTTTGCTGACTATGCTGAGGCTCACTTGAAGCTCT
CTGAATTGGGATTCGCTGAAGCTTAAGATGCTGATTGGTAGAGTTGGGAGTGGCGGCATGTTTTTGTTTATGTTTCACTTCTGAAAAGCT
TGCTGGGATTATTTATTTTTGTCTTCTGTTGCTACTCCTTATATCATGATTTGAATTTGGCAGCTTTATTAGACGATGCTATTGTCACTC
TCTTCCAGCTTAAGAAGTT


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
X81376 cytosolic ascorbate peroxidasecytosolic ascorbate peroxidase
apx1 cytosolic ascorbate peroxidase DQ002888ascorbate peroxidase
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (31)  
Alignment image suppressed for unigene with 31 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None