Unigene SGN-U196076

Unigene Basic Information 
Unigene ID: SGN-U196076
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196076
mRNA sequence: Length: 821 bp

>SGN-U196076 Capsicum annuum #1 (98 members)
GTAAGCTTGAGAAATTTCTAGAGAGAAAAAAGAGAATGGCAAATCCAAAGGTTTTCTTTGACCTCACCATCGGCGGCCAACCGGCCGGAC
GCGTCGTGATGGAGCTGTTCGCCAACGATGTTCCTAAGACGGCGGAAAACTTCCGTGCACTCTGCACCGGCGAGAAGGGCGTCGGAAGGA
TGGGTAAGCCTTTGCACTACAAAGGCTCCACCTTCCACCGTGTGATCCCAGGGTTCATGTGTCAAGGAGGTGATTTCACCGCCGGAAACG
GTACTGGAGGAGAATCGATTTACGGCGCTAAGTTTGCTGATGAAAACTTTAAGAGGAAGCACACCGGACCTGGAGTTCTATCCATGGCTA
ATGCTGGACCTGGAACCAACGGTTCACAATTCTTCATCTGCACTGCTAAGACTGAATGGCTTGATGGAAAGCACGTTGTTTTTGGTCAGG
TTGTTGAAGGATTTGATGTGATTAAGAAGGCTGAAGCTGTTGGATCCAGCTCTGGAAGGTGCTCTAAGCCTGTTGTGATTGCTGACTGTG
GTCAACTCTGCTAGATCTGATGGACCCTTGATGATGATGATCTAGTGTTATTATCAGTCCTAATATTTGAGTCGCCGTTTTAGGCCTTTG
TTTTTAATTTTAATCTATGTTTACTGTTTGGTTGGGTTGGGTCGGGTTGAAGGGTCTAGGGTTTTGCTGTAATTGGTATTGGTTTGGCTT
GTACCAGTTTATGTTTTAATCTTAAGACTACTACAATTAAATAAGATAATAGATTTCATCTAAAAAAAAAAAAAAAAAAAAAACTCGAGA
CTAGTTCTCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cacyp1 cyclophilin 1
Genomic locations (0)None
Library representation (6)  
mRNA member sequences (98)  
Alignment image suppressed for unigene with 98 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None