Unigene SGN-U196120

Unigene Basic Information 
Unigene ID: SGN-U196120
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196120
mRNA sequence: Length: 2013 bp

>SGN-U196120 Capsicum annuum #1 (76 members)
GTTGTTCATTCTCTATAAGCGGCCAGGGTTTTAGCTAAAGTTTCTCTCTCACTTTTCGTACTCTAAAAGTTTCTCAGGCATCATGGGTAA
AGAGAAAATTCACATTAGCATTGTTGTCATTGGTCATGTCGACTCTGGAAAGTCGACCACTACTGGTCATTTGATCTACAAGCTTGGTGG
TATTGACAAGCGTGTCATCGAAAGATTCGAGAAAGAAGCAGCTGAGATGAACAAGAGGTCCTTCAAGTATGCTTGGGTGCTTGACAAGCT
GAAGGCAGAGCGTGAACGTGGTATTACCATTGATATTGCCTTGTGGAAGTTCGAGACCACAAAGTACTACTGCACTGTCATTGATGCCCC
TGGACACAGGGATTTTATCAAGAACATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTT
TGAAGCTGGTATCTCCAAGGATGGACAGACCCGTGAGCACGCATTGCTTGCTTTCACCCTCGGTGTCAAGCAAATGATTTGCTGCTGTAA
CAAGATGGATGCTACCACCCCCAAATACTCCAAGGCCAGGTATGATGAAATTGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTTGGGTA
CAACCCTGACAAAATCCCCTTTGTCCCCATCTCTGGTTTCGAAGGAGACAACATGATTGAGCGATCAACTAATCTCGACTGGTACAAGGG
CCCAACCCTACTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAGGCCCTCAGACAAGCCACTCCGTCTCCCACTTCAGGATGTCTACAA
GATTGGTGGTATTGGAACTGTGCCTGTTGGTCGTGTTGAAACCGGTGTCATTAAGCCTGGTATGGTTGTGACTTTTGGTCCTACTGGTCT
GACTACTGAAGTTAAATCTGTTGAGATGCACCATGAGGCTCTTCAGGAGGCTCTTCCTGGTGACAATGTCGGTTTCAACGTCAAGAACGT
TGCTGTTAAGGATCTCAAGAGAGGTTATGTTGCTTCTAACTCCAAAGATGACCCAGCAAAGGGCGCTGCCAGCTTCACTGCTCAAGTCAT
CATCATGAACCATCCTGGTCAGATTGGAAACGGATATGCTCCAGTGCTCGATTGCCACACCTCCCACATTGCTGTCAAGTTTGCTGAGAT
CTTGACCAAGATCGATAGACGTTCTGGTAAGGAACTTGAGAAGGAGCCCAAATTCTTGAAGAATGGTGATGCTGGTATGGTTAAGATGAT
TCCCACCAAGCCCATGGTGGTTGAAACTTTTGCTGAGTACCCACCATTGGGACGTTTTGCTGTGAGGGACATGCGTCAAACTGTTGCTGT
TGGTGTCGTCAAAAATGTTGACAAGAAGGACCCTACTGGTGCCAAAGTCACCAAGGCTGCTCAGAAGAAGAAGTGAGGTGTTTTTGATGA
GATTCTGGATTTATGAACTAGTTTTGTTTAATTGCATTAGCTATTTTCGATTTTGTTTTGAACAATTTACCTGCACTGGAAATGTCTCTA
GAAGCTTTGTCATGGTTCTCTAGCCTCTTTTGAGGATACTGGAGTTATCGAGCAATTTGGTTTTTATCCAAGTTGCTTGATGGGCAATGA
CATTAGTACCTCTGGATGCCTTTCTCGTGTCTGTTTTTTATAGCGAATTTCAAGATGATCTGCTGAGACGGTTTTAATATGTGTTTTTGG
GATATCTTTTCTCTTCTAAAAAAAAAAAAAAAAAAAAAACGTGCAAAGGGAAGTTACTGATTATTGGAAAAAATATGTTTTAGCTAGAAA
AGCAGCTGCTTGCTAGGGGCATTACGGACTTTTTTGCCTCGCCTGCTACTGAAAAGAGAGAGTCGATGCCATTATTGATGCCATTATTCA
CTTGGGTCGAGAACCAACTGCATTTGAATTTTATTATTAATTACAAAAAAATAATGAATTCTGCTTTTTTTTTGTTCTGCAAGCCCTGCT
GAGTGACTAACAAAATTCTATAAAGAATGATGA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
AF242732 translation elongation factor 1a
AY490176 U-Lim
Genomic locations (0)None
Library representation (7)  
mRNA member sequences (76)  
Alignment image suppressed for unigene with 76 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None