Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U196129

Unigene Basic Information 
Unigene ID: SGN-U196129
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196129
mRNA sequence: Length: 2230 bp

>SGN-U196129 Capsicum annuum #1 (24 members)
GGATCCCCTTCTTGGTGATGTCCAAGTTTATCCTGAGAAAGGTACCGTTGCTTTCTCTGCTGGATTGCATGGTTGGGCTTTCACTCTCAC
CAATTTTGCCAAGATGTACGCTTCCAAATTTGGTGTTGATGAGTCTAAGATGATGGAAAGACTCTGGGGCGAGAACTTTTTTGACCCTGC
CACCAAAAAGTGGACCACCAAAAACACTGGAACAGCTTCATGCAAGCGTGGGTTTGTTCAGTTCTGCTATGAGCCCATCAAGCAGATTAT
TAACACTTGCATGAATGATCAGAAAGATAAACTCTGGCCAATGTTGCAGAAGCTTGGTGTAACCATGAAATCTGATGAAAAAGATTTGAT
GGGCAAGGCACTGATGAAGCGTGTGATGCAGACCTGGCTTCCCGCAAGTACTGCTCTTCTGGAAATGATGATATACCATCTTCCATCTCC
TTCCACAGCTCAAAAATATCGTGTGGAGAACCTCTACGAGGGACCTCTTGATGATGCGTATGCCAATGCCATCAGGAACTGTGACCCAGA
AGGGCCGCTTATGCTTTATGTATCCAAGATGATTCCAGCATCTGACAAGGGTAGATTCTTTGCTTTTGGTCGTGTATTCGCTGGGAAGGT
TAGTACTGGTATGAAGGTTAGAATCATGGGTCCCAACTATGTTCCTGGTGAAAAGAAGGATTTATATGTTAAGAATATCCAGAGAACTGT
TATTTGGATGGGTAAGAGGCAAGAAACTGTTGAGGATGTACCCTGTGGTAACACTGTTGCCATGGTCGGTTTAGATCAATTTATTACCAA
GAACGCAACATTGACTAATGAAAAGGAAGTTGATGCCCACCCAATTAGAGCAATGAAGTTTTCTGTATCACCAGTCGTGCGTGTAGCTGT
TCAGTGCAAGGTTGCATCTGACCTTCCCAAGCTTGTTGAAGGGTTGAAGCGTTTGGCTAAGTCTGATCCTATGGTGGTTTGTTCTATTGA
AGAGTCTGGAGAGCATATCATTGCTGGTGCTGGAGAACTCCACCTTGAGATCTGCCTGAAGGACTTGCAGGATGACTTCATGGGTGGTGC
TGAAATTATAAAATCTGATCCTGTTGTGTCCTTCCGTGAGACTGTTCTCGAGAAGTCTTGTCGGACAGTGATGAGCAAGTCTCCTAACAA
GCACAACCGTTTGTACATGGAAGCTAGACCAATGGAAGAAGGCCTTGCAGAGGCTATTGACGAGGGGCGCATTGGCCCAAGGGATGATCC
TAAAGTTCGATCCAAGATCTTGGCGGAGGAGTTTGGTTGGGACAAAGATCTTGCAAAGAAAATTTGGTGCTTTGGGCCAGAGACAACTGG
CCCAAACATGGTGGTGGATATGTGTAAGGGAGTTCAGTACCTGAATGAAATTAAGGATTCTGTTGTTGCTGGTTTCCAGTGGGCTTCGAA
GGAAGGTGCTCTGGCTGAAGAGAACATGAGAGGTATTTGTTTTGAAGTCTGTGATGTTGTGCTTCATGCTGATGCTATTCACAGGGGTGG
TGGCCAAGTTATTCCCACTGCGAGAAGGGTTATCTATGCTTCTCAGCTTACTGCCAAACCCCGCCTGTTGGAACCCGTTTACCTTGTGGA
GATTCAGGCTCCAGAGCAAGCTCTTGGTGGCATCTATAGTGTTCTGAACCAGAAGCGTGGACATGTGTTCGAGGAGATGCAGAGGCCAGG
AACCCCTCTTTACAACATCAAGGCTTACCTTCCTGTCGTTGAGTCATTTGGATTTTCAGGTACCTTGAGAGCTGCTACTTCAGGTCAAGC
TTTCCCACAATGCGTGTTCGATCATTGGGACATGATGTCATCCGACCCACTGGAAGCTGGTACACAAGCTCATCAACTCGTCCTTGATAT
CCGCAAGAGGAAGGGTTTGAAGGAGCAGATGACCCCTCTATCAGAGTTCGAGGACAAGCTGTAAGCTTGTGGAAGTTTCAACTTGGCAGA
GGTTTTTGATGGATACTTGCTTAATTGGATCTGCATTAGTTTTGTTTTACATTATGTGTTTGGGCCGTACTTTTTATACTTTTTACCATT
TTCCAGGTAGAAGTTTGAACCTTAAGTGAGATATTGCTTTTGTCAGTTACAAAGATGAGAATCTTGCTGTTGTGTTGTTTTTGAAAGTGT
TTTAGTTCTTCTGTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCGAGACTAGTTCTCTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY480021 elongation factor 2
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (24)  
Alignment image suppressed for unigene with 24 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None