Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U196174

Unigene Basic Information 
Unigene ID: SGN-U196174
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196174
mRNA sequence: Length: 1535 bp

>SGN-U196174 Capsicum annuum #1 (12 members)
CTCCAAGTCAAGTGCTCTCTCTTTTCCCTCTTCTTGCCCCGCAACTTTCAATCGTTGAAGCGATCGAAAGATGTTTGGAAGAGCACCGAA
GAAGAGTGATAATACGAAGTATTATGATATCTTAGGAGTACAGAAAAGTGCTTCACAAGATGATCTCAAAAAGGCTTATCGTAAAGCCGC
CATCAAAAATCATCCTGATAAAGGAGGCGATCCTGAAAAGTTTAAAGAGATTGCCCAAGCTTATGATGTCTTGAGTGACCCCGAGAAGCG
TGAAATATATGATCAGTATGGGGAGGATGCTCTTAAGGAAGGAATGGGTGGTGGAGGTGGTGGACATGACCCATTTGATATATTTCAATC
ATTCTTTGGTGGTGGTGGAAGCCCCTTTGGTGGTGGTGGAAGCAGCAGAGGCAGAAGACAAAGAAGAGGAGAGGATGTTATCCACCCTCT
CAAGGTCTCTTTGGAGGATCTTTACAATGGGACATCAAAGAAGCTTTCACTATCTCGCAATGTGTTGTGCTCAAAGTGCAAGGGTAAAGG
GTCCAAGTCAGGTGCTTCAATGAAGTGTTCTGGCTGTCAAGGGTCTGGAATGAAAGTTTCTATCAGACAGCTTGGTCCATCCATGATCCA
GCAGATGCAGCACCCTTGCAATGACTGTAAGGGTACCGGTGAGACAATCAGTGACAAAGATAGGTGCCCACAGTGTAAGGGTGAGAAGGT
TGTGCAGGAGAAGAAGGTGTTGGAAGTTCACGTGGAGAAGGGTATGCAGAACGGGCAGAAGGTAACATTCCCAGGCGAGGCAGATGAAGC
GCCAGAAACTATCACTGGAGACATAGTTTTTGTCTTGCAACAGAAGGAACATCCTAAATTCAAGAGAAAGGGAGATGATCTTTTTGTTGA
GCATACATTGACCTTGACTGAGGCCCTATGTGGTTTCCAGTTCGTCTTGACTCACCTAGACAACAGACAGCTGCTCATTAAGTCCCAACC
TGGCGAAGTTGTCAAGCCTGATCAGTTTAAGGCTATCAACGATGAAGGAATGCCGATGTACCAAAGGCCTTTTATGAGAGGTAAACTGTA
CATTCACTTCACTGTTGATTTCCCAGAGTCATTAACACCAGAGCAGTGCAAGAACCTTGAGGCCGTGCTTCCTCCCAAACCCAAACAGCA
AGTGTCTGACATGGAATTAGACGAGTGCGAGGAGACTACTTTGCATGATGTGAACATTGAGGATGAGATGCGAAGGAAGCAGCAACCTGC
CCAAGAGGCATATGGCGAAGATGATGATATGCATGGTGGTGGTGCACAGAGAGTCCAATGTGCACAGCAGTAATTTGGTAGTGTTCTGGT
ATTTGTGCTGTCTTGTGATAGAGGGTAGATTACTAAAGGGTTTGGTTGTTTTTCTTATGCAAACTTGACACTACGAGCAGAATTTTACTG
CTCGACTATTGTAAGTGTGCTTACATGTTTACGCAATTCGTTTTATTTTATTCAATAATTCTTCTTAAAAAAAAAAAAAAAAAACTCGAG
ACTAG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY491517 DnaJ-like protein AY491517
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (12)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None