Unigene SGN-U196361

Unigene Basic Information 
Unigene ID: SGN-U196361
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196361
mRNA sequence: Length: 784 bp

>SGN-U196361 Capsicum annuum #1 (47 members)
TTTAGTTTCAATTTCCTCTCTATAAATACCCTTAGATCTCTCTAGCTTTTATACCCAACAATCGAGCAACAAATACTTTACATTTGTAGT
ATATCCTTCAATCCACTACTCTCTTCATACTACTCTTTTTCTTTAAGCATGGAAGGGATAGGCAAGATTGCATGTTTTGTGCTTTTGTGC
ATGGTGGTAGTTGCACCCCATGCAGAGGCACTGAACTGCGGTCAAGTTACATCTGCCATGGCCCCTTGCGTTCCTTATTTGATGGGCCGT
GGTCCTCTTGGAGGCTGCTGTGGTGGAGTTAAAGGTCTAATGGGTGCAGCCAAGACCCCAGCGGACCGAAAAACAGCATGCACTTGCCTG
AAATCAGCAGCTAATTCTATGAAGGGCATTGATGCAGGCAAAGCTGCTGGTCTCCCTGCTGCTTGTGGCGTCAACATTCCTTATAAGATC
AGCCCTTCCACTGACTGCTCCAAGGTCCAGTAAAGCTGTTCACCATAATTTGGTATCATGAGAAAATCAAGAATAAGATGGATATCTAGT
TTGATCTTGCTTATGGATCCATCTTGCTTATGGATTCATCACTATATATGTTGTCTCTTTATTTTCATTTATATATGTTGTCTCTTTATT
TTCATTTGCATATGTTGGAGTAATAGTCGAGTTTTGTAATGAACCTTGCTGGTTGGTTGTATTACAACCCAATCTTCATCGTAATACAAA
AAAAAAAAAAAAAAAAAAAAAAAACTCGAAACTAGTCCTCTCTCTCCTCTCTTGGCTGGATTAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AY829652 non-specific lipid transfer protein AY829652lipid transfer
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (47)  
Alignment image suppressed for unigene with 47 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None