Unigene SGN-U196433

Unigene Basic Information 
Unigene ID: SGN-U196433
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196433
mRNA sequence: Length: 977 bp

>SGN-U196433 Capsicum annuum #1 (10 members)
CATAATAGAGAGAGAGAGAAAGAGGGAGAGTTAAATCAGCAAAAGAGGAGTTGTTAATTGTAGAAGAATGGGTGGTTGGGCTATAGCGGT
GCACGGTGGCGCTGGTGTGGATCCAAATCTCCCTGCTGAACGTCAAGAAGAAGCCAAACATCTCCTTACTCGTTGTCTTAATATTGGAAT
CTCTGCTCTTCGCTCTTCTCTCCCCGCCATTGATGTCGTTGAACTCGTCGTGAGGGAATTGGAAAGTGATCCTTTATTCAATTCGGGTCG
TGGATCTGCATTAACTGCAAATGGAACAGTGGAAATGGAGGCGAGCATTATGGACGGCGACGGTAGACGATGCGGCGCCGTTTCTGGTAT
ATCCACCGTGAAAAATCCCATCTCTCTTGCTCGTCTCGTCATGGACAAATCCCCTCATTCCTACCTCGCTTTCTCCGGCGCCGAAGAATT
CGCCAAACAACAGGGTGTTGAGATGGTGGACAATGACTATTTCATCACCGAGGACAATGTTGGAATGCTGAAACTAGCCAAAGAGGCTAA
CACCATTTTGTATGATTACAGAATTCCAATAACTGGATTGGAATCCTGTGCAGCATCTGTAGAGAGTCCAATTCACATGAATGGTTTACC
AATAAGCGTTTACGCCCCGGAGACTGTTGGGTGTGTGGTGGTTGATGGTCAAGGGAGGTGCGCCGCCGCCACGTCAACCGGTGGTTTGAT
GAACAAAATGACCGGTAGAATCGGTGACTCACCATTGATTGGTGCTGGGACCTACGCAGGTGAACTATGTGGGGTGTCATGTACAGGTGA
AGGAGAAGCCATCATACGTGGAACCCTACCACGTGACGTGGCACGCACTTATGGAGTATAAAGAATCGGGCCTTCAAGATGCAGTGGACT
ATGTGATTAAGAAGAGATTGGATAAAGGGTTTGCTGGGCTAATTGGTGTGTCCAACAAAGGGGAAGTGGCATATGGG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (10)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (1)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None