Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U196599

Unigene Basic Information 
Unigene ID: SGN-U196599
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196599
mRNA sequence: Length: 700 bp

>SGN-U196599 Capsicum annuum #1 (5 members)
ACTGAGGCTCTATGTGGTTTTCAGTTTGTCTTGACTCACTTAGACAATAGACAGCTGATGATTAAGTCCCAACCTGGAGAAGTTATCAAG
CCTGATCAGTTCAAGGGCATAAATGATGAAGGAATGCCGCTGTACCAGAGCTCGTTCATGAGAGGTAAACTGTACATTCACTTCACTGTG
GACTTCCCGGACGCATTAACCCCAGAGTTGTGCAAGAATCTTGAAGCAGTGCTGCCCCAAAAACCCAAAACACAAGCGACCGATATGGAA
TTGGATGAGTGCGAGGAGACCACCTTGCATGATGTCAACATTGAAGAGGAAATGCGCAGGAAGCAGCAGCAACAGGCCCAAGAGGCATAT
GAAGAAGATGATGACGATATGCATGGTGGTGCCCAGAGAGTGCAATGCGCACAACAGTAATTTGACAATGGACACACTCGTGGTAGATAA
CAGGAGTTCATTCCGTCAAGGGGAAGTATCAAGCCCAGGTATTGTTGTTTTTCTAATAGGGATGGTAAGAAGTGACAGCCAGGAACAACA
TTGTTTCTAGTGGGGAGATAGATTGCTATGCCTTTGGAATTTTATTTATGCTAGTGTACTGTAAGCAAAATTTTGTTATTGACAAATTGT
AAGAGTGCTGGTGAAAGATCATTGCTAGTTGTTTTGATTTACAACTTAATTCAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (5)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None