Unigene SGN-U196865

Unigene Basic Information 
Unigene ID: SGN-U196865
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 196865
mRNA sequence: Length: 568 bp

>SGN-U196865 Capsicum annuum #1 (5 members)
ATCATTTATAAGTTATATATAAGAAATATATATTCGATCGATCATGGCAGATGTGAAGTCATCAGTTGTTTCACTATTCCTATTGGGCCT
GTTGGTGGTGGTGCTGCAAAGCGGGGTGATCGAGTGTCAGCCGCAGATATGCAACCCATCGCTTACAAGCCTGAACGTGTGCGCACCATT
TGTGGTGCCAGGTGCACCCTCTGCTAGCGCGGAGTGTTGCACAGCACTGCAATCAATTAATCATGGCTGCATGTGCGACACTATGCGTAT
CGCAGCTCAAATTCCCGCTCAATGCAACCTCCCTCCTCTCTCTTGTGCTGCAAATTGAGTTTGAGGTCAGTGCCAGCAATTTTACAGCCG
CTACATGAGCAAATTAAATGATATTGTAACAATAAATTTACGCTGTTCCTTCTATCTCTTCTTTCTTTTTGTTTGTGTTGCTCTTTAACT
GATGTTGTCACTCCTCTGATCGGCGACAGAGCAAGGTTAGGAAAGAGCTTGTACTGTCATATGATCATCGATAAATAAAATATGTGACTT
GATTAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (5)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (5)  
Preceding Unigenes (0)None