Unigene SGN-U197457

Unigene Basic Information 
Unigene ID: SGN-U197457
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 197457
mRNA sequence: Length: 897 bp

>SGN-U197457 Capsicum annuum #1 (3 members)
GAAAATCGCCCTTGATTTCTGTGAAGCAGTGAAGTCCAACATCCAAAGATTACATATGCAGATCTGTACCAGCTTGCAGGTGTTGTTGCT
GTTGAGGTCACTGGTGGTCCTACTATTGATTTTGTCCCTGGTAGGAAGGATTCCAGTATTTCTCCAAAGGAAGGGCGGTTACCAGATGCT
AAACAAGGTGTGCCACATCTTAAAGATGTCTTTTATAGGATGGGTTTGTCTGACAAAGATATAGTGGCGCTATCAGGGGGTCATACACTG
GGAAGGGCACATCCAGAGAGATCAGGCTTTGATGGTCCATGGACAAAGGAGCCTCTGAAATTTGACAATTCATATTTTGTGGAGCTGCTT
AAGGGGGAAAGTGAGGGCCTACTGAAACTACCCACAGACATTGCTTTATTGGATGATCCTGAGTTCAGACACTATGTCGAGCTGTATGCT
AAGGATGAAGATGCCTTCTTTAGGGATTACGCCATATCACACAAGAAACTGTCTGAGCTAGGGTTTACCCCAAGTTCTGGTTCCAAGGCC
ACAGTGAGGGATGGTACTATTTTAGCACAAAGTGCTGTAGGAGTTGTAGTGGCTGCTGCAGTTGTGGCACTGAGTTACTGGTATGAAGTC
CGGAAAAAGATGAAGTAAATTGTACGACCACATTCTTATCTCCATATTTACTACTACGTACTCTTCAATGATAAAAGTGGACCTTATTTT
TATGGTTATAACACACTTTCCTCAAATAATAGCACGTAGTGTCGACTAAATGGAATTAGTACAAAAATATAGTAAGAAACTGGTTGTACC
CTTGGAATATATGTTTATATTTGATACCCATACTTTGGAGGGTTTCTTATACTCTCTGCGTTGGTTTTTGTCTCAGATGCTTTTTGC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
AF442387 ascorbate peroxidase AF442387ascorbate peroxidase
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None