Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U198052

Unigene Basic Information 
Unigene ID: SGN-U198052
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 198052
mRNA sequence: Length: 593 bp

>SGN-U198052 Capsicum annuum #1 (2 members)
AAAAAGTGAAGTTGATCATCTTGAAGATGGCTATAGATGGAGAAAATATGGCCAAAAAGCTGTTAAAAATAGTCCATTTCCAAGGAGTTA
CTATCGTTGTACAAATACAAAGTGCACAGTAAAGAAGAGAGTGGAACGATCCTCTGAAGATTCCTCAATTGTAATCACGACATATGAAGG
ACAGCATTGTCATCATACAGTTGGATTTCCTAGAGGTGGACTTATCAATCATGAAGCTGCATTTACATCTCAATTATCACCTTTACCCTC
ACAATACTATCATCCCTCCGGTGTTCAGTACCCGCATGAATTAGTTCCTATGACTGCGGCTGCACCAGTAGAATCGCGTACAATGCCAGG
TGAAACTGGATCATCAGAAGCTCGTAGATTGCCAGAAACAAGTCAACCTGCTGCAACTGATGAGGGATTGCTTGGAGATATTGTACCTCC
TGGGATGCGAAGCAGATAATATTAAGGGTAATCCCTTTCCTATAATTCGTCAACTTGTTACTATCTTGACATGCTGCATTGATTCATCAT
TCTANAAAATTTCATCAACGACATATATATTATGTGATCATTACATGTGAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
wrkya WRKY transcription factor-atranscription factor
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None