Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U199495

Unigene Basic Information 
Unigene ID: SGN-U199495
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 199495
mRNA sequence: Length: 712 bp

>SGN-U199495 Capsicum annuum #1 (1 members)
GAAATGTCTTCCTATTTAGAATCACCAAAGCTTCCGGTTCGAGAAATCCCAGGGGACTATGGTTTCCCTATTATTAGCGCGATTAAAGAT
CGATACGATTATTTTTATAACCAAGGTGAAGATGCTTGGTTCCATGGCAAAGCTGAAAAATACAAATCTACTGTTGTCAAAATCAACATG
GCACCTGGTCCTTTCACCTCTAATGATTACAAATTGGTGGCATTTTTAGATGCCACCAGCTTCGTTTACATGTTTGATAACACCCTCATC
GACAAGACTGACACTCTTGGTGGTACATTTAAGCCTGGCAAAGAATACTATGGTGGTTATCGTCCAGTCGCATTCGTCGATACGAAAGAT
CCGAACCATGCAGCATTAAAAGGCTACATTCTATCTTCGTTTGCAAAGAGACATAACTTATTCATACCTCTTTTCAGGAACTCTCTATCT
GATCACCTCTTTAATGATCTAGAAAAACAAGTCTCTGAACAAGGGAAATCGGATTTCAATGCGTTGCTACCTAATATGACGTTTGGTTTC
ATTTTTCGTTTGCTTTGTGATCAGACTAATCCGTCTGATACAGTTCTTGGCGCTCAGGGACCAGAACATCTTCGCAAATGGCTTTTCCCT
CAGCTCATTCCGTCCTTGAGCGCCAGAAAACTTCCCAGTTTTATAGAAGATTTGCTCTTCCATAACTTCCTGATACCATTTG


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
DQ832721 divinyl ether synthasedivinyl ether synthase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E492878
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None