Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U199997

Unigene Basic Information 
Unigene ID: SGN-U199997
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 199997
mRNA sequence: Length: 619 bp

>SGN-U199997 Capsicum annuum #1 (1 members)
TTTTTTTTTTTTTTTTCAACAAGACACGACTAGTTCTATTTCAAATGCAAAAATTGCTTACAGTACACATGCACAAGAGCGTTTTCTCTT
TATAATCTATATTGTTTTATACTCTAGATCAATTAGGTGGATGAGTGTATGAATTGTACAGGTTGCAGTATATGTTCATGATATTATACG
GCTGCTGGGGTAGGTACAGCAGCAGGGACACGGTTTTCAGCAGGAATTTCCACAAATTCTGAGAGAATAGCACGGAATTCATCTCCTGTC
ATCGTCTCCTTTTCAAGGAGGACTTCCACAATCTTATCAATGGCTTCACGGTTGCTGCGGATTTGGCTCAACGCAATCTCATATGCACTG
TCTGAAAGCCTCTTCACAGCAGCATCGATGTCTTCAGCTAGCTTTTCTGACATTGAGTTCCTGGCCATCATTCTCATGATTACATCACCA
CTTTGGGCTGAAGCATCCATGAGTGACCAGGGGCCAAGTTCAGACATCCCAAAAGTGACAACCATCTGCATGGACAGTCGATCATTTTCC
AGAACTGTTTTGCCAAACTGGTGATCTGCTGCAAATAACCAGCAGCACCAGTTGTCACTTCAGGTGCACCAAAGATCAC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cacp chloroplast protease
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E491011
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None