Sol Genomics Network

Unigene SGN-U200258

Unigene Basic Information

Unigene ID:	SGN-U200258
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	200258
mRNA sequence:	Length: 428 bp

>SGN-U200258 Capsicum annuum #1 (1 members)
GAGAACTACTCTCGAGTTTTTTTTTTTTTTTTTGAAAAAAACATAAACATTAAACCAAAGAGATGATAAAATTTTTACATACAATAGAGG
AGAGGTGGCACCAAAATAATGTAACATGGAGTTCATGTCATTTTTTTTTTTCTTTTAAACTTTCTATACAATGCAACACTGAACTCCAAA
TCCCCAAAGCTTAACACAAATGTTGCCTGCTACTTATGAGTAGTCTTGTGCTGGTGGTGCTGGCACTCAACAGGGGCAACAGGGAACCTA
GCAGTATCAGTGCAATAATCATAGACCATATGGTTAGCCCTGACCCAAATCAACTGATGGCTCTGGTGCACACTCAACTCGGACATAACC
GGTTCATCCCACCAGTACCTCTTCTGACCATTGCTGCTGCAACGCTGAGTATTCTCAGCGACTGCAGC

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
AY512584	sadtomato protein

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS10	Hairy root	2179	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E506532
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	95	Glyco_hydro_16	133
2	22025	Glyco_hydro_16	130
5	56288	Glyco_hydro_16	128
1.1	101462	Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Concanavalin A-like lectin/glucanase	129
2	118454	Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Concanavalin A-like lectin/glucanase	122
5	128954	Glycoside hydrolase family 16 - Molecular Function: hydrolase activity hydrolyzing O-glycosyl compounds (GO:0004553) - Biological Process: carbohydrate metabolism (GO:0005975) Xyloglucan endo-transglycosylase C-terminal - Cellular Component: cell wall (GO:0005618) - Biological Process: glucan metabolism (GO:0006073) - Molecular Function: xyloglucan:xyloglucosyl transferase activity (GO:0016762) - Cellular Component: apoplast (GO:0048046) Concanavalin A-like lectin/glucanase subgroup Concanavalin A-like lectin/glucanase	122

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer