Unigene SGN-U200666

Unigene Basic Information 
Unigene ID: SGN-U200666
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 200666
mRNA sequence: Length: 523 bp

>SGN-U200666 Capsicum annuum #1 (1 members)
GCTTCGGCTGCTTTATCAGTAGCCAATTCTTCTCTCCACGTCACCAACAAAAGATCATTCTCAGAGTTCACTGGGCTTCGCACCTCATTT
GCCCTTCCATTCGGAAAGAAAGCTAACGATGACTTGCTCTCTTTTGTTGCTTTCCATAACTCTGTTATTGGTGGAGGAAAGAACAAGGGG
AGAGTAGTGGAGGCAAAATTGAAGGTAGCCATCAACGGATTTGGAAGGATCGGAAGGAATTTCTTGAGGTGCTGGCATGGCAGGAAGGAC
TCTCCCCTAGAAGTCATTGCCATCAATGACTCTGGCGGTGTCAAGCAAGCCTCTCACCTCCTCAAGTACGACTCTACCCTTGGCATCTTT
GACGCTGACGTCAAGCCTGTTGGTACTGATGGCATCTCTGTTGATGGAAAGGTCATCAAAGTCGTCTCCGACCGCAACCCCATCAATCTC
CCCTGGAAGGATCTTGGAGTTGACTTGGTGATCGAAGGTACCGGAGTTTTTGTGGACAGAGAGGGTGCTGGGA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
gapa2 glyceraldehyde-3-phosphate dehydrogenase, subunit GapA2glyceraldehyde-3-phosphate dehydrogenase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E503887
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None