Unigene SGN-U202369

Unigene Basic Information 
Unigene ID: SGN-U202369
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 202369
mRNA sequence: Length: 371 bp

>SGN-U202369 Capsicum annuum #1 (1 members)
GTGGAGGTAGGGCCAGAGGTAACAAAATTCAAAGTGGGGGACACAGTTGGAGTTGGATTGATAGCCGGATGTTGCACCAACTGCAGGCCT
TGCAAACAAGACATAGAGCAATATTGAGCAAAGAAGATATGGAATTGCTATGATGTCTACACTGATGGCAAGCCCACTCAGGGTGGCTTT
TCTAATTTCATGGTTGTTGAGCAAAAGTTCGCGGTGAAAATTCCAGAGGGTATGGCACCAGAACAAGCAACACCACTATTATGTGCTGGT
GTGACAGTGTACAGTCCATTGAACCATTTTGGTTTTAACCAAAGTGGACTAAGAGGTGGAATATTGCGACTTGGAGGAGTTGGACACATG
GGAGTGAAAAT


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
CAD Cinnamyl Alcohol Dehydrogenase Enzyme of lignin and possibly capsiconate biosynthesis
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E489272
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None