Unigene SGN-U202535

Unigene Basic Information 
Unigene ID: SGN-U202535
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 202535
mRNA sequence: Length: 397 bp

>SGN-U202535 Capsicum annuum #1 (1 members)
CTCACCTCGTCCCCATCACCCTCTTCTTCTAAATCAGCTGGTGTTCTTCGTTTTTTATCAACTGATTCAATGGCTTCCGATTATTCATCA
ACTCCAGTTACTCTTAACAACGTTAATCCCAAGGTTTTGAAATGTGAGTATGCTGTCCGAGGAGAAATTGTCAACCTTGCTCAGAAATTA
CAGCAAGACCTTAAGGAGAATCCAGGCTCTCATCCCTTTGATGAGATCTTATACTGCAATATTGGAAATCCTCAATCCCTGGCTCAGCAG
CCAATTACTTTCTTTAGGGAGGTCCTTGCATTGTGTGATCATCCACTTATTTTGGACAAAAGTGAAACACAAGGTTTGTTCAGTGCGGAT
TCAATAGAACGAGCTTTCCACATTCTAGACCAAATTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
alaat alanine aminotransferasealanine aminotransferase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E502232
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None