Sol Genomics Network

Unigene SGN-U203867

Unigene Basic Information

Unigene ID:	SGN-U203867
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	203867
mRNA sequence:	Length: 324 bp

>SGN-U203867 Capsicum annuum #1 (1 members)
GATGGATCTGAAGTCACGTGTAGATGGACCAGCCCAAGCTTATGTCGTCGAGGCAAGGGTTGATAGAGGACGGGGTCCATTGGCTACTGC
AATAGTGAAAGCAGGAACCCTTGTCTGTGGTCAGCATGTTGTTGTAGGTGCGGAGTGGGGAAAAATCAGGGCTATTAGGGATATGCTAGG
AAAATTGACTGATAGAGCTAGGCCAGCTATGCCCGTGGAGATTGAGGGACTCAAAGGGCTTCCAATGGCTGGTGATGACATTATTGTCGT
TCACTCTGAGAAAAGGGCAAGGATGCTTAGCGATGGGAGGAAAAAGAAACTTGA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS11	Early root	2168	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E508392
[Show Image]

Markers Information (1)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	50	ProtSyn_GTPbind	231
2	25109	EFTU_D2 Cons_hypothATPbd Small_GTP Ras_trnsfrmng LepA ProtSyn_GTPbind EF1_alpha IF2 tRPa TIF_aIF-2 TEF_SelB IF2_N EF-Tu ArgK	7
5	61342	EFTU_D2 Cons_hypothATPbd Small_GTP Alpha_E2_glycop Ras_trnsfrmng LepA ProtSyn_GTPbind EF1_alpha IF2 tRPa TIF_aIF-2 TEF_SelB IF2_N EF-Tu ArgK	4
1.1	101378	Heavy metal transport/detoxification protein - Biological Process: metal ion transport (GO:0030001) - Molecular Function: metal ion binding (GO:0046872)	495
2	120922	Elongation factor Tu domain 2 - Molecular Function: GTP binding (GO:0005525) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Translation factor Protein synthesis factor GTP-binding - Molecular Function: GTP binding (GO:0005525) - Biological Process: protein biosynthesis (GO:0006412) Initiation factor 2 - Molecular Function: translation initiation factor activity (GO:0003743) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: translational initiation (GO:0006413)	7
5	133792	Elongation factor Tu domain 2 - Molecular Function: GTP binding (GO:0005525) Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Translation factor Protein synthesis factor GTP-binding - Molecular Function: GTP binding (GO:0005525) - Biological Process: protein biosynthesis (GO:0006412) Initiation factor 2 - Molecular Function: translation initiation factor activity (GO:0003743) - Molecular Function: GTP binding (GO:0005525) - Cellular Component: intracellular (GO:0005622) - Biological Process: translational initiation (GO:0006413)	4

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer