Sol Genomics Network

Unigene SGN-U204061

Unigene Basic Information

Unigene ID:	SGN-U204061
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	204061
mRNA sequence:	Length: 396 bp

>SGN-U204061 Capsicum annuum #1 (1 members)
TTGCTATCCGGCTTCAGAAGCACTCCAAGACTCTTGGAGGATTTGGTGCTTGGAATAGATGTTTAAATCACCTGTTGACGCTTGCAGAGT
CTCATATCGAATCGTTCATCCTTGAAAAGTTCATTGAAGCAGTTAAAAACTGTCCTGATGAAAGCTCTCGTGCTGCCCTAAAACTCGTGT
GTGATCTTTATGCCCTGGATAGAATCTGGAATGACATAGGCACGTACCGCAATGTAGACTACGTGGCCCCTAACAAAGCTAAGGCAATTC
ACAAGCTAGCAGAATATCTAAGTTTCCAAGTTAAGAATATTGCAAGGGAACTTGTTGATGCCTTTGATCTTCCAGATTATGTTACGCGTG
CTCCAATTGGTGTGCAGACCCCATCAGAAGCTTATT

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS11	Early root	2168	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E507847
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 3 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	251	Acyl-CoA_dh_M Acyl-CoA_dh_C	62
2	22881	ACOX	18
5	59650	ACOX Acyl-CoA_dh_M IucA_IucC Acyl-CoA_dh_C	6
1.1	101614	Acyl-CoA dehydrogenase central region - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA dehydrogenase type1/2 C-terminal - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA dehydrogenase middle and N-terminal Acyl-CoA dehydrogenase C-terminal-like	58
2	119591	Acyl-CoA oxidase C-terminal - Molecular Function: acyl-CoA oxidase activity (GO:0003997) - Cellular Component: peroxisome (GO:0005777) - Biological Process: fatty acid beta-oxidation (GO:0006635) Acyl-CoA dehydrogenase middle and N-terminal Acyl-CoA dehydrogenase central region - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA dehydrogenase type1/2 C-terminal - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118)	14
5	132135	Acyl-CoA oxidase C-terminal - Molecular Function: acyl-CoA oxidase activity (GO:0003997) - Cellular Component: peroxisome (GO:0005777) - Biological Process: fatty acid beta-oxidation (GO:0006635) Acyl-CoA dehydrogenase middle and N-terminal Acyl-CoA dehydrogenase central region - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA dehydrogenase type1/2 C-terminal - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA dehydrogenase type 1 - Molecular Function: acyl-CoA dehydrogenase activity (GO:0003995) - Biological Process: electron transport (GO:0006118) Acyl-CoA oxidase - Molecular Function: acyl-CoA oxidase activity (GO:0003997) - Cellular Component: peroxisome (GO:0005777) - Biological Process: fatty acid metabolism (GO:0006631) - Molecular Function: FAD binding (GO:0050660)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer