Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U204865

Unigene Basic Information 
Unigene ID: SGN-U204865
Unigene Build: Capsicum annuum #1
Date: 2003-12-15
Organism: C.annuum
Alternative ID: 204865
mRNA sequence: Length: 613 bp

>SGN-U204865 Capsicum annuum #1 (1 members)
GGTTTGTCTAACATAAAACACAGAAAGTCTTTAAGAAGGATGTTTATGGAAGGAAAATTTTATATTCCTCAAATCTTCCATCGTCTGGTA
AAACATCAAGAGTAGTTGTAAAAGCATCTCTTCAGCAAAGGCCGGATGAAGGAAGAAGAGGCTTTCTTAAATTATTGCTTGGAAATGTTG
GGCTTGGAGCGCCTGCTTTGTTAGGTAATGGAAAAGCCTATGCTGATGAGCAAGGTGTTTCTAACTCAAGGATGTCTTATTCTAGATTTT
TGGAATATCTGGACAAGGATAGGGTGCAAAAAGTAGATTTGTTTGAAAACGGAACCATAGCTATTGTTGAGGCTGTATCTCCAGAATTAG
GAAACCGGGTGCAAAGAGTTAGGGTACAACTACCCGGGCTCAGCCAGGAACTTCTTCAAAAGTTCCGGGAAAAAAACATCGATTTTGCTG
CTCACAATGCTCAAGAGGACTCAGGTTCTCTCATATTCAACTTGATTGGAAATCTGGCATTCCCGCTTATTTTGATTGGTTGTCTTTTCC
TGCTATCAAGGCGGTCTAACGGAGGAATGGGAGGTCCTGGTGGGCCTGGTAACCCACTAGCATTTGGTCAATC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
cacp chloroplast protease
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E488117
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None