Sol Genomics Network

Unigene SGN-U204950

Unigene Basic Information

Unigene ID:	SGN-U204950
Unigene Build:	Capsicum annuum #1
Date:	2003-12-15
Organism:	C.annuum
Alternative ID:	204950
mRNA sequence:	Length: 508 bp

>SGN-U204950 Capsicum annuum #1 (1 members)
TATAACAGCATCAGCTGGAAATCATGCAATGGGTGTTGCATTAAGTGCTCAAAAACTTAAATCTAGTGCTACAATTGTCATGCCTGTTAC
CACCCCAGAGTTCAAGAGGGAAGCAGTTGAAAATACGGGCGCTACGGTAATTCTTAGGGGCAACACATTTGATGAAGCTCACGAATATGC
AATGACCATGTCTCAAGATGAAGATCTCACATTCATCCCACCATACGATCATCCTGATATCATCAAAGGCCAAGGTACAATCGGAGCAGA
GATTAGCCGTCAATTTAGTAAATCAGTACATGCAATATTTGTACCTATTGGTGGTGGGGGGTTAGCGGCCGGTATAGCTACCTATATGAA
ACAAGTTTCACCAAGTACAAAAATTATTGGAGTTGAACCATATGGTGCATGTTCAATGGCATTGTCATTGTCAAATGGAGTAAGAGTAAA
GTCGGAAAATGTTGATAATTTGGCTGATGGTGTTGCTGTTGGACTTGTTGGTGAACAG

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Capsicum annuum	KS10	Hairy root	2179	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E505208
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 2 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	199	Cysta_beta_synth Cys_synthM B6_enzyme_beta Cys_synthKM Cys_synthK	74
2	23195	Cysta_beta_synth Thi4 Thr_synthase Thr_dehydrateI Cys_synthM B6_enzyme_beta Cys_synthKM Trp_synth_beta S/T_dehydrtse_BS Thr_dehydrateII Cys_synthK Trp_synth_b_like Amcycprop_deam HTH_GntR ThrDh_C PyridoxP_deam	15
5	57504	Cysta_beta_synth Thi4 Thr_synthase Thr_dehydrateI Cys_synthM B6_enzyme_beta Cys_synthKM Trp_synth_beta S/T_dehydrtse_BS Thr_dehydrateII Cys_synthK Trp_synth_b_like Amcycprop_deam HTH_GntR ThrDh_C PyridoxP_deam	13
1.1	101578	Pyridoxal-5&apos -phosphate-dependent enzyme beta subunit - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152)	70
2	119604	Threonine dehydratase I - Molecular Function: threonine ammonia-lyase activity (GO:0004794) - Biological Process: isoleucine biosynthesis (GO:0009097) Pyridoxal-5&apos -phosphate-dependent enzyme beta subunit - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152) Serine/threonine dehydratase pyridoxal-phosphate-binding site - Biological Process: amino acid metabolism (GO:0006520) Threonine dehydratase C-terminal - Molecular Function: threonine ammonia-lyase activity (GO:0004794) - Biological Process: isoleucine biosynthesis (GO:0009097)	14
5	129927	Threonine dehydratase I - Molecular Function: threonine ammonia-lyase activity (GO:0004794) - Biological Process: isoleucine biosynthesis (GO:0009097) Pyridoxal-5&apos -phosphate-dependent enzyme beta subunit - Molecular Function: catalytic activity (GO:0003824) - Biological Process: metabolism (GO:0008152) Serine/threonine dehydratase pyridoxal-phosphate-binding site - Biological Process: amino acid metabolism (GO:0006520) Threonine dehydratase C-terminal - Molecular Function: threonine ammonia-lyase activity (GO:0004794) - Biological Process: isoleucine biosynthesis (GO:0009097)	14

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer