Sol Genomics Network

Unigene SGN-U205654

Unigene Basic Information

Unigene ID:	SGN-U205654
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	205654
mRNA sequence:	Length: 535 bp

>SGN-U205654 Solanum melongena #2 (5 members)
ACAATTCTAGGGTATTTTAGTAACATGAGTAATTACCCGAAAAACTAATTGGTAGCTGAGAGCGATCGAAGAAAGTCGGAAGAGCAATGG
CGTCGAATGCTGCTGCACCATTTTGGAGATCGGCGGGGATGACTTACATAACCTACTCAAATCTTTGCGCCAACCTGGTCAGGAATTGCC
TTAAGGAACCTTACAAGTCGGAAGCCCTCGCTCGGGAAAAGGTCCACTACTCTATCAGCAAATGGGTTGATGGCAAGCCTCAGAAACCCA
CCATCCGCTCTGATACGCCGGAAGATTGAAGTAAGGTTGAATCTCAGGCATTGTTTCTTCTCAGAGTGTCTTTGTACTGCCTCGGCACCA
TACAGAGTGCATATTTGCTGGAGGTTGATTGGGACATTTTAGCTTTCAATAATATAGCCAATAGACTTTGTTCTTTTCTGTTGGATGCAG
ATGATATAATTTTTCCCGTGTTATGTTGAATCTATTATTGTTTTGAAATCCAAGTGAATTGATGATCAAAAAAAAAAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	5

mRNA member sequences (5)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2903	ATP_synth_E	6
2	25602	ATP_synth_E	6
5	59593	ATP_synth_E	6
1.1	101736	UBA-like	42
2	120982	ATPase F1 complex epsilon subunit mitochondrial - Cellular Component: mitochondrion (GO:0005739) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	7
5	131233	ATPase F1 complex epsilon subunit mitochondrial - Cellular Component: mitochondrion (GO:0005739) - Biological Process: ATP synthesis coupled proton transport (GO:0015986) - Cellular Component: proton-transporting two-sector ATPase complex (GO:0016469) - Molecular Function: hydrogen-transporting ATP synthase activity rotational mechanism (GO:0046933) - Molecular Function: hydrogen-transporting ATPase activity rotational mechanism (GO:0046961)	7

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer