Unigene SGN-U205775

Unigene Basic Information 
Unigene ID: SGN-U205775
Unigene Build: Solanum melongena #2
Date: 2004-01-12
Organism: S.melongena
Alternative ID: 205775
mRNA sequence: Length: 464 bp

>SGN-U205775 Solanum melongena #2 (3 members)
AGTTTACTCCTACTTTCCTCTTCATTTCTTCCTTCTTCTCCTCCATAAAAATCCCTAGAAAAATCTCCATCAAATTCCAAGCAAAACCCA
CCAATTTTCTTGGCTTCTAGGTGTAGCAATCACCATGGCAGCTGTGTTTGAGTCCTTGAAGTTATGGGGTTTTTGGGCAGTTGTACTTGC
TGCAGCTACGGCTGTGAAGGGGAATTCAGAAGGGGATGCTTTGTACGCCCTTCGCCGGAGCTTATCCGACCCGAATAACGTGCTCCAGAG
CTGGGATCCGAATCTTGTCAACCCCTGTACCTGGTTTCATGTCACTTGCAATGGAGATAGTCAAGTTACTCGTGTGGACCTTGGCAACTC
AAATTTATCTGGTCATTTGGTACCTGAGCTTGGAAAGCTTGAACATCTACAGTATTTGGAGCTTTACAAAAATAATATTGAGGGAACCAT
CCCTAAAGAGCTTG


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None