Sol Genomics Network

Unigene SGN-U205937

Unigene Basic Information

Unigene ID:	SGN-U205937
Unigene Build:	Solanum melongena #2
Date:	2004-01-12
Organism:	S.melongena
Alternative ID:	205937
mRNA sequence:	Length: 428 bp

>SGN-U205937 Solanum melongena #2 (2 members)
TTTTTTTTTTTTTTTTTTATAACTTGGAAACATATATAGTATGAGTGGAATTCTTTAAAGTGTGTTGGCTTCATCCAAAGTGCCAAATTA
CTACTCAATGAGTAATCTAAAAAGACAAGTATCGCGTCATTTTAGGCCTCGGAAACTGTTCATGATTTGTGCTGCAAAAATGTTCAACTC
AGAGAAAGACTGCGGTTGGATCGCCTGGTGATGGTGGATTTTGCCTCACGACTGCAGCATGAGGCCCTGCTCTCTCCAGAGCATCGTCTG
TCATAGATAAGATCTCCAATCTTTCGAGACCAAGTTGTCTCTTGATCAAGTCTGAGTTCTCCACAAGGACTTCAATCTCACCAAAAGGAA
GCCTCAAGTCCAATGCTTGAACCCCAACTGCCAAAACTTCGTCTTTCTTGAACCTCAAGAAAGGCATA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Solanum melongena	cSML	buds & flowers anthesis-stage flowers, 4-8 week old plants	4031	2

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	385	tRNA-synt_val tRNA-synt_I tRNA-synt_1a Leu-tRNA-synt1a tRNA-synt_ile	44
2	23916	tRNA-synt_val tRNA-synt_I tRNA-synt_1a Leu-tRNA-synt1a tRNA-synt_ile	10
5	58555	tRNA-synt_val tRNA-synt_I tRNA-synt_1a Leu-tRNA-synt1a tRNA-synt_ile	8
1.1	101679	tRNA synthetase valyl/leucyl anticodon-binding Aminoacyl-tRNA synthetase class 1a anticodon-binding	47
2	120282	Leucyl-tRNA synthetase archae/euk cytosolic class Ia - Molecular Function: leucine-tRNA ligase activity (GO:0004823) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: protein biosynthesis (GO:0006412) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aminoacyl-tRNA synthetase class 1a anticodon-binding tRNA synthetase valyl/leucyl anticodon-binding	9
5	131148	Leucyl-tRNA synthetase archae/euk cytosolic class Ia - Molecular Function: leucine-tRNA ligase activity (GO:0004823) - Molecular Function: ATP binding (GO:0005524) - Cellular Component: cytoplasm (GO:0005737) - Biological Process: protein biosynthesis (GO:0006412) Aminoacyl-tRNA synthetase class I - Molecular Function: aminoacyl-tRNA ligase activity (GO:0004812) - Molecular Function: ATP binding (GO:0005524) - Biological Process: tRNA aminoacylation for protein translation (GO:0006418) Aminoacyl-tRNA synthetase class 1a anticodon-binding tRNA synthetase valyl/leucyl anticodon-binding	7

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer