Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U206198

Unigene Basic Information 
Unigene ID: SGN-U206198
Unigene Build: Solanum melongena #2
Date: 2004-01-12
Organism: S.melongena
Alternative ID: 206198
mRNA sequence: Length: 200 bp

>SGN-U206198 Solanum melongena #2 (1 members)
GTGGATCCAAAGAAAAAATTGTAAAATCTATCTCTGCACAATTAATGGCAAATTTTTTGCGTTTCTTTGCTAGTGTGCTACTTCTAGCAA
TGCTTGTCATGGCTACTGAGATGGGACCAATGAGAATCGTAGAGGCAAGAACTTGCGAGTCGCAAAGCCACCGTTTCAAGGGACCATGTG
TGAGTGCGACAAATTGTGCC


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E514839
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (3)  
Gene Family (6)  
Preceding Unigenes (0)None