Unigene SGN-U207414

Unigene Basic Information 
Unigene ID: SGN-U207414
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 207414
mRNA sequence: Length: 584 bp

>SGN-U207414 Petunia hybrida #1 (3 members)
CCACACAGACGCTGGTGGCATAATCCTTCTGTTCCAAGATGACAAAGTAAGTGGCCTACAACTCCTCAAAGACGGCCAATGGATCGATGT
TCCTCCCATGCGCCATTCCATTGTGGTTAACCTCGGTGACCAACTCGAGGTGATCACTAATGGAAAATACAAGAGTGTGATGCACAGAGT
GATAGCCCAAAAAGACGGGGCTCGAATGTCATTAGCTTCCTTTTACAATCCAGGAAGTGATGCAGTGATCTATCCAGCACCAGCTCTTGT
TGAGAAAGAAGCAGAGGAAAACAAACAAGTCTACCCAAAATTTGTATTTGATGATTACATGAAGTTATATGCTGGACTCAAGTTTCAAGC
TAAGGAGCCAAGATTTGAAGCAATGAAAGCCATGGAAACTGATGTCAAGATGGATCCAATTGCCACTGTCTAATAGATGGAAGTTGGATA
AAAATGATTTGTTATTAAAAGTAGTACAAGACCTGTGACATATATTATATGTTTCTTTAGTATAGTGTGATCAATCTATTTACAAGAGGG
GTGTGTCCCTACTATATATGTAGTTTGTCCCTACTACATATGTA


[Blast] [AA Translation]
Associated Loci (5)  
Locus symbolLocus nameGene activity
PETACO1A 1-aminocyclopropane-1-carboxylate oxidase11-aminocyclopropane-1-carboxylate oxidase
PETEFE ethylene forming enzyme
PETACO4A 1-aminocyclopropane-1-carboxylate oxidase 41-aminocyclopropane-1-carboxylate oxidase
PETACO3A 1-aminocyclopropane-1-carboxylate oxidase 31-aminocyclopropane-1-carboxylate oxidase
PETACO2A potential 1-aminocyclopropane-1-carboxylate oxidase 2potential 1-aminocyclopropane-1-carboxylate oxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None