Unigene SGN-U207452

Unigene Basic Information 
Unigene ID: SGN-U207452
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 207452
mRNA sequence: Length: 629 bp

>SGN-U207452 Petunia hybrida #1 (6 members)
GGCTTCCTCAGTTATCTCCTCGGCAGCCGTTGCTACTAGCAGCAATGCTGTTCAAGCTAGCATGGTTGCACCTTTCACTGGCCTAAAATC
TGCCTCAGCTTTCCCTGTTACCAAGAAGAACAACCTTGACATTACTTCCCTTGCTAGCAATGGTGGAAGAGTTTCATGCATGCAGGTATG
GCCACCATATGGAAAGAAGAAGTACGAGACACTCTCATACCTTCCCGATTTGACCGACGAACAATTGCTCAAAGAAATTGAGTACCTTTT
GAACAAGGGATGGGTTCCTTGCTTGGAATTCGAGACTGAGCACGGATTTGTCTACCGTGAATATCACGCATCACCAGGATACTATGATGG
AAGGTACTGGACAATGTGGAAGTTGCCCATGTTTGGTTGCACTGATGCTACCCAAGTCTTGGGTGAGCTCCAAGAGGCCAAGAAGGCTTA
CCCAAATGCATGGATCAGAATCATCGGATTCGACAACGTTCGTCAAGTGCAGTGCATCAGTTTCATTGCCTACAAGCCCGAAGGCTACTA
AAATCTCTCAACATTATTAGGGCAATTTAATTACCCTATGAAGCTGGTTGTTTGATTTGTACTTAAGTTTTTTATTTTTACCCCACAAA


[Blast] [AA Translation]
Associated Loci (7)  
Locus symbolLocus nameGene activity
PETRBCC ribulose-1,5-bisphosphate carboxylase PETRBCCribulose bisphosphate carboxylase
PETRBCA ribulose 1,5-bisphosphate carboxylase PETRBCAribulose 1,5-bisphosphate carboxylase
rbcs ribulose bisphosphate carboxylaseribulose bisphosphate carboxylase
PETRBCS1B ribulose bisphosphate carboxylase 1Bribulose bisphosphate carboxylase
PETRBCS1F ribulose-1F
PETRBCS1C ribulose-1C
SSU611 ribulose bisphosphate carboxylase SSU611ribulose bisphosphate carboxylase
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (6)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None