Unigene SGN-U207458

Unigene Basic Information 
Unigene ID: SGN-U207458
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 207458
mRNA sequence: Length: 716 bp

>SGN-U207458 Petunia hybrida #1 (21 members)
AATTGCAAAAACCAAACACTTCAATATCACATTTTAACACTAGTGAATATTCGAAATGGCAAAGGTAGCATTTTTGTTTGTGGCAATGTG
CATAGCAGCAGTAGCTGTGATGCTAACTCCCACTTCAGAAGCTGCTATATCTTGTGGCCAAGTTGTAACAAGCTTGAGATCATGCATTGC
CTATGTGAAGCAAGGTGGTGCATTGCCAGTAGCATGTTGTAGTGGGATTAAGTCCCTTAACAGCCAAGCTACTACTACTCCAGATCGTCA
GGCAGCATGCAGCTGTATTAAATCTGCAGCTGGTAGCATCAATGGCATCAACTTCAGCCTTGCTTCTAGTCTCCCTAGCAAATGTGGTGT
CAACCTTCCTTACAAGATTAACCCTAAAATTAACTGCTCCACGGTGCAGTAAGATTTGTGAAGTAACGAATGGTAGCAGGATGAGTAATA
TAGGGCATACAAGAGATGGAATAAATAAGATGAGTTCATGGAGTAGATGGATGAAGCTTTCGCAGCATATCCTCTATATAATTAGTTATG
CGATCATATATAGTTTAGTAGTGTGTGTATGTTCCCTATCTTGCTATTAAGAACTTCAAAAGATTGTATCCTTTCAATTTCGATCTATTG
AATATATGATATCCTGCTACTTCTAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (3)  
mRNA member sequences (21)  
Alignment image suppressed for unigene with 21 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None