Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Unigene SGN-U207468

Unigene Basic Information 
Unigene ID: SGN-U207468
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 207468
mRNA sequence: Length: 1765 bp

>SGN-U207468 Petunia hybrida #1 (20 members)
GTTGTTTCTTTTTCTCTCCACTACGCGGCCAGTGTTTAAGGTCATCTTCCCTCTTCTTAAAGTTTCTTAGGCAACATGGGTAAAGAGAAG
TTTCACATTAACATTGTGGTCATTGGCCATGTCGACTCTGGAAAGTCGACCACTACTGGTCACTTGATCTACAAGCTTGGTGGTATTGAC
AAGCGTGTCATTGAGAGGTTTGAGAAAGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCTTGGGTTCTTGACAAGCTTAAGGCC
GAACGTGAACGTGGTATTACCATTGATATTGCTTTGTGGAAGTTTGAGACCACCAAGTACTACTGCACTGTCATTGATGCCCCTGGACAC
AGGGACTTTATCAAGAACATGATTACTGGTACCTCCCAGGCTGACTGTGCTATCCTGATTATTGACTCCACCACTGGTGGTTTTGAAGCT
GGTATCTCTAAGGATGGACAGACCCGTGAGCACGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATTTGCTGCTGCAACAAGATG
GATGCTACCACCCCCAAGTACTCCAAGGCTAGGTACGATGAAATTGTGAAGGAGGTTTCTTCCTACCTCAAGAAGGTTGGATACAACCCA
GACAAGATCCCCTTCGTCCCTATCTCTGGTTTCGAAGGAGACAACATGATTGAAAGATCAACCAACCTTGACTGGTACAAGGGTCCAACC
CTCCTTGAGGCTCTTGACCAGATTAATGAGCCCAAGAGACCCTCAGACAAGCCCCTCAGGCTGCCACTTCAGGATGTCTACAAGATTGGT
GGTATTGGTACCGTCCCAGTCGGTCGTGTTGAAACTGGTGTCCTTAAGCCTGGTATGGTTGTGACTTTTGGTCCAACTGGTTTGACCACT
GAGGTCAAGTCTGTTGAGATGCACCATGAGGCTCTTCAGGAAGCACTTCCTGGTGACAATGTTGGGTTCAATGTCAAGAATGTTGCTGTT
AAGGATCTTAAGCGTGGTTTTGTTGCCTCCAACTCCAAGGATGATCCAGCTAAGGGTGCTGCCAGCTTCACCTCCCAAGTCATCATCATG
AACCATCCTGGTCAGATTGGAAACGGATATGCCCCAGTGCTCGACTGTCACACTTCCCACATTGCTGTCAAGTTTTCTGAAATCTTGACC
AAGATTGACAGGCGATCTGGTAAGGAGCTCGAGAAGGAGCCTAAGTTCTTGAAGAATGGTGATGCTGGCATGGTTAAGATGATTCCCACC
AAGCCCATGGTGGTTGAGACCTTCTCCGAGTACCCTCCATTGGGTCGTTTTGCTGTCAGGGACATGCGTCAGACCGTGGCTGTTGGTGTG
ATTAAGAGTGTTGACAAGAAGGACCCAACTGGTGCTAAGGTCACCAAGGCTGCACAAAAGAAGAAGTGAAGTGGTTTGATGAGATTCTGC
GTGGATGAACTAGTTTTGTTTTACTGCATTAGCTATTTTCAATTTTGTTTTGAACATTTTACCAGATATGGATGTGGCTTCAGTAGCTTT
TGTCATGGTTCTCTAGCCTCTTTGGAGGATAGTGGAGTTATTGAGCAATTTGGTTCAGTCCAAGTTGCTTGATGGGCAGTGACAAATAGC
ACTCTGGACCTCTCTCTGTCTGGTTCATTTTATAGCAAATTTCAAGATGAGCTGTAGTGGCTGAGACGGTGTTTTATTTATATTGTGCTT
TCTAAACATCTCCCTTCTACTTTAAGTTTCCTTTGGTATTTCCTTAAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (5)  
mRNA member sequences (20)  
Alignment image suppressed for unigene with 20 aligned sequences.
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 5 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None