Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U207568

Unigene Basic Information 
Unigene ID: SGN-U207568
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 207568
mRNA sequence: Length: 640 bp

>SGN-U207568 Petunia hybrida #1 (4 members)
GTCTAAAGCGTACCGGAAAAAGTTGTCGACTTCGGTGGCTTAATTATCTCCGGCCAGATGTCCGGAGGGGAAATATTACACCTGAAGAAC
AGCTCTTGATTATGGAACTGCATGCTAAGTGGGGAAACAGGTGGTCAAAAATTGCAAAGCATTTGCCAGGAAGAACTGATAATGAGATAA
AGAATTATTGGAGGACTAGGATACAGAAGCACATTAATAAGCAAGCAGATCAAAACATGAAGAAACCATCAAAATGTGAGCAAAATGATC
AAAAAGCAATTAGTACAAGTCAAGCATCTACTGGTCCAACAGATACCATTGACTCATATTCTCCATCTTCATATACTGAAAATACTAATA
ATAATATGGAAAATATTACCTTTCAAGGCAATTTTCCAACTGAAACAAATGAAAATATTTGGAGCATGGAAGATCTCTGGTCCTTGCAAT
TGCTTAATGATGCAACCAACTAATTATAATTAATTAGTAATCTAGCTGCTGCCTAGCAACTATTATGTAAAGAGTTTAAATGTTCACATA
CATTATCTTTTTATGTCTATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
PH4 R2R3 myb binding proteinpH control in epidermal petal cells
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (4)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 2 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None