Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U208192

Unigene Basic Information 
Unigene ID: SGN-U208192
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 208192
mRNA sequence: Length: 453 bp

>SGN-U208192 Petunia hybrida #1 (3 members)
CCTTCTCGAGTGAAAATGGCAGGCATGCTTGCTGGTGTTGAATGTGCTAGGAGAAGAAAGTTACATCAAAACGGTGGCTGGTTAACTTCT
TCTAATGCATCTGATAATTCATCCACAAGAAGGTCTTTTCTTTGTCTCTACACAAGCAACCATGAACATACTCTTAGCTCAAGCTTTTCC
AAGGAAAGAAGTGCAATAAGTGAAGAATATAATGAAGACGATAAACTAGGAGAAGTAGCCAGAGAAGCAAAGCAAAGGCTACATAAGAGG
CTCACTGTCCAATTGAAATCACAAAACAAAAGGAGTACTAAGGGATGGAGGGGGATGATTTGCTGATACACAAAGTGTTTGGATCAAACA
AGTTGCAGTTAAGGGAAGCTGTTTTTCAAGCTTCGCAGAAAATATGGATTGTGTCTCATCTGCTATAGGATCAATTCATATGCACTTCCC
ATT


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (3)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (5)  
Preceding Unigenes (0)None