Unigene SGN-U208383

Unigene Basic Information 
Unigene ID: SGN-U208383
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 208383
mRNA sequence: Length: 637 bp

>SGN-U208383 Petunia hybrida #1 (2 members)
GTAGGCCTGCTGCTGCAGAAGGAGCAAGGATAGCAGGGGCTTCAAGGATTATCGGTGTGATTTGAATGCAAGCAGATTTGAGCTAGCAAA
GAAATTTGGCGTGACAGAATTTGTGAACCCGAAGGACTATAACAAACCAGTTCAAGAGGTTATTGCTGAGATGACTGATGGAGGAGTCGA
CAGAAGCGTAGAGTGCACTGGCCACATTGATGCTATGATTTCTGCATTTGAATGTGTCCATGATGGCTGGGGAGTGGCTGTACTTGTGGG
AGTACCCCATAAAGAAGCTGTGTTTAAGACACATCCAATGAACTTGTTGAATGAAAGGACTCTCAAGGGCACTTTCTTTGGGAACTACAA
GCCACGATCCGATCTCCCTTCTGTTGTGGAGAAATACATGAATAAGGAACTTGAATTGGAGAAGTTCATAACTCATCAACTCCCATTTTC
TGATATCAACAAGGCTTTTGATCTCATGCTGAAAGGAGAAGGTCTTCGCTGCATCATCCATATGGAGCACTAAGCTTGTATAAAAATTTT
CCCAACAGTATCTTCCTTTGTTATGTTATTCCTTTGCAAAAGCCTATAAATAACTGGCGTTTCTGCTTTTCCTTCCAAAAAAAAAAAAAA
AAAAAAA


[Blast] [AA Translation]
Associated Loci (3)  
Locus symbolLocus nameGene activity
adh3 alcohol dehydrogenase 3alcohol dehydrogenase
Adh2 alcohol dehydrogenasealcohol dehydrogenase
ADH1 alcohol dehydrogenase 1alcohol dehydrogenase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None