Sol Genomics Network

Unigene SGN-U208497

Unigene Basic Information

Unigene ID:	SGN-U208497
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	208497
mRNA sequence:	Length: 370 bp

>SGN-U208497 Petunia hybrida #1 (2 members)
ATAAAATTGAGGAGTACAGTGATGAGATCTTCAAACTGCTGGATGAAGGGGCTCACATCTATTTCTGTGGGTTGAAGGGGATGATGCCCG
GAATCCAAGACACTCTGAAGAGGGTTGCTGAGGAGAGAGGTGAGAGCTGGGACCAGAAGCTTTCACAACTCAAAAAGAACAAGCAATGGC
ATGTTGAAGTCTACTAATTAAGAAATGTTTATTGGTTACATTTGTTTGTGATTGTTGATTGTTGATTGTTGTCAAATGAACTTAGCGGCA
TGCAGCTTAGATGACATTGTACTGCTAGTAGACATAAAAACTGTTTGTTCTACAATAGAAATGAAATAATAACTGTTGGTACTTCAGGCA
AAAAAAAAAA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-C2H4	all floral organs anthesis	3072	2

mRNA member sequences (2)

To view details for a particular member sequence, click the SGN-E# identifier.

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 0 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	297	FPN_cyt_redctse Oxred_FAD/NAD(P)	53
2	22665	FPN_cyt_redctse Oxred_FAD/NAD(P)	22
5	58038	FPN_cyt_redctse FAD_binding_6 Oxred_FAD/NAD(P)	10
1.1	101624	Oxidoreductase FAD/NAD(P)-binding - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) Flavoprotein pyridine nucleotide cytochrome reductase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	56
2	118990	Ferredoxin--NADP reductase - Molecular Function: ferredoxin-NADP+ reductase activity (GO:0004324) - Biological Process: electron transport (GO:0006118) - Cellular Component: thylakoid membrane (GO:0042651) - Molecular Function: FAD binding (GO:0050660) - Molecular Function: NADP binding (GO:0050661) Oxidoreductase FAD/NAD(P)-binding - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) Flavoprotein pyridine nucleotide cytochrome reductase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	23
5	130608	Ferredoxin--NADP reductase - Molecular Function: ferredoxin-NADP+ reductase activity (GO:0004324) - Biological Process: electron transport (GO:0006118) - Cellular Component: thylakoid membrane (GO:0042651) - Molecular Function: FAD binding (GO:0050660) - Molecular Function: NADP binding (GO:0050661) Oxidoreductase FAD/NAD(P)-binding - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491) Flavoprotein pyridine nucleotide cytochrome reductase - Biological Process: electron transport (GO:0006118) - Molecular Function: oxidoreductase activity (GO:0016491)	9

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer