Unigene SGN-U208671

Unigene Basic Information 
Unigene ID: SGN-U208671
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 208671
mRNA sequence: Length: 764 bp

>SGN-U208671 Petunia hybrida #1 (2 members)
GTTGACAGAGCATGTCCACCTCGCAAGAAGATGAAGGGAGACAATAATGGACTGTATGATAACAAAAGGACTGTATTTGTGGGCAACCTT
CCATTTGATGTGAAGGATGAAGAGATTTATCAGTTGTTCTCTGGTATAAAAGAGTTGGAATCGAGCATTGAAGCTGTTCGAGTGATCAGA
GATCCCAATACCCTCCTGGGAAAAGGAATTGCATATGCTATGTTCAAAACGAGGGAGGCTGCCAACTTTGTTTCTAGAAAGCGCAATTTG
AAGCTACGGGATCGTGAGCTTAGGGTGTCCCATGCTAAAGCAAACTCCACTCCCTCTAAAAGGAAAAGCTCATCAGAAGGCAGATTCAGT
TCTCCAGCAAAGAAATTTGCATATTCAGCTACTCCAGGTGGTAGCGACAAGGGGAAAGCAAAAGCTGCAGTCTCCTACCAGGGTATGAAA
GCAAGCAAATCGGGTGTCCAGAAGAAAACTCAATCCAAGATCAGCCACCGAGGAATGTCAACACCGAAAACACAGATATCGCAAAAGCCA
ATAGATCGCAAAGCAAAGAGACCATCTGTNGCTGCCCGAAAAGCAAAGGAACTCAAGGCTGCTGCCTCTGGCTTGAAACAATTCGGGACA
AAACGGAAGCTGGAAAGCAGAACACCTGACTCTGCTGGCAGGAAGAAGAAATTTAGAAAACCTTAGGTCGTCTTGCATTGTCCACAATGT
TATACACCAGATAGTGTTCATCATTCGTATGTTCACTTTTCAGA


[Blast] [AA Translation]
Associated Loci (0)None
Genomic locations (0)None
Library representation (2)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 1 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None