Unigene SGN-U208893

Unigene Basic Information 
Unigene ID: SGN-U208893
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 208893
mRNA sequence: Length: 643 bp

>SGN-U208893 Petunia hybrida #1 (2 members)
AGAAATAAGAAGAAGACATTCCCCTCTTCTTCTTTGTTAAGAAAAAAAAAAAAAAAAAAATTCCCCCAAAAAAACAAAAAAATTCCCAAA
AAAAGTGTGGGGGACAAGGAGGAACCATGGAGAGAGCTAGTTTTACCGTTGTGGCTTTGCTACTTTGCCTCTCCATTGGAAATGTGGTGG
TGAAAGCTGAGGACCCTTACCTCCCTTTTGATTGGAATGTTACCTATGGCACTATTTCTCCATTAGGGGTGCCACAACAAGGCATCCTCA
TAAATGGACAGCTCCCAGGACCAACCATCAACTGCACCTCAAACAACAACATTGTTGTCAATGTCTTTAACCATCTAGATGAGCCATTAC
TCATAACCTGGAATGGTATCCAACAAAGGAAGAACTCGTGGCAGGATGGTACCCCAGGAACCATGTGTCCTATCATGCCTGGTACAAACT
TTACCTATCACTTCCAAGTCAAGGACCAGATCGGTAGCTTCTTCTACTTCCCGACAACAGACTTGCATCGTGCAGCAGGTGGTTTGGGTC
CCATCAATGTCCACAGCCGTAACCTTATTCCTATTCCTTTTGACAGCCCTGCCGCTGAATACAATGTCTTCGTGGGTGATTGGTACAACA
AGGGTTACAAGTC


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
p303 1-ascorbate oxidase1-ascorbate oxidase
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (2)  


To view details for a particular member sequence, click the SGN-E# identifier.
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None