Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Unigene SGN-U209114

Unigene Basic Information 
Unigene ID: SGN-U209114
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 209114
mRNA sequence: Length: 581 bp

>SGN-U209114 Petunia hybrida #1 (1 members)
AAAAAACATTTGGTTATTATTTACTTGTGTTCACTGTAGTACACTTTGCTACTATGGCTCGCTCCATCTGTTTCTTCGCAGTTGCTACAC
TGGCATTGATGCTCTTTGCTGCCTATGAGGCGGAAGCGGCAACTTGCAAGGCTGAATGCCCAACTTGGGATGGAATATGTATAAATAAAG
GCCCATGTGTAAAATGTTGCAAAGCACAACCAGAAAAATTCACAGACGGGCACTGCAGTAAAGTACTCCGAAGATGCCTATGCACTAAGC
CGTGTGCAACTGAAGAGGCAACTGCAACTTTGGCTAACGAGGTAAAGACTATGGCTGAAGCTTTGGTCGAAGAAGATATGATGGAATAAG
AGATTACTTGTATGTGTCACACACAAGTATAGTCCTCTATATATAGAGGATCATGGTTCAGTTTCCTAGTGTTTGATGTTTGTATTATGT
TCTTGGCTTTATAAGTAGCCCTTTGTTAATTGAATAAGTGTGACACATCCTCTTTATGGAGCTCTATATATCCAAATTTATGGTTTTATT
TTAAACAATTAAAATTATCGGCATGGTAAAAAAAACAAAAA


[Blast] [AA Translation]
Associated Loci (2)  
Locus symbolLocus nameGene activity
D2 floral defensin-like protein 2floral defensin-like protein
D1 floral defensin-like protein 1floral defensin-like protein
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E520921
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 1 | go: 0 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None