Sol Genomics Network

Unigene SGN-U209160

Unigene Basic Information

Unigene ID:	SGN-U209160
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209160
mRNA sequence:	Length: 476 bp

>SGN-U209160 Petunia hybrida #1 (1 members)
CCTCATTCTCACTGACCCAAGAACCGATCACCAGCCTATTAAGGAAGCTGCACTTGGTAACATCCCAACTATGCTTTCTGCGATACTGAT
TCACCAATGCGATATGTCGACATTGGTATCCCTGCCAACAACAAGGGAAAGCACAGCATTGGTGTTCTTTTCTGGCTCTTGGGAAGGATG
GTACTGCAGATGCGAGGTGTCATTGCTCAGGGACACAAGTGGGATGTCATGGTGGATCTCTTCTTTTACAGAGAGCCTGAAGAGGCAAAG
GAGCAACAAGAAGAGGAAGCACCTGCTATTGCAGATTACCCAGAATACGGTGGTGCTGCACTTGGTGGTGATTGGTCTAGCAGCCAAATC
CCTGATGGTCAATGGGGTGCAGATGCCGTAGCTCCTGTCCCCGCAGTTGCTGCTACTGGCTGGTCTGGAGATGGAGTCGCTGATGGAGGT
TGGGAAAGTGTAGCTGCTCCTCCTGC

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-DevA	all floral organs several	2870	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E522437
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 4 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	1387	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13
2	23313	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13
5	57395	Ribosomal_S2_b/o Ribosomal_S2 Ribosomal_S2_e/a	13
1.1	102508	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	13
2	119678	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	13
5	130131	Ribosomal protein S2 - Molecular Function: structural constituent of ribosome (GO:0003735) - Cellular Component: intracellular (GO:0005622) - Cellular Component: ribosome (GO:0005840) - Biological Process: protein biosynthesis (GO:0006412) Ribosomal protein S2 eukaryotic and archaeal form - Molecular Function: structural constituent of ribosome (GO:0003735) - Biological Process: protein biosynthesis (GO:0006412) - Cellular Component: small ribosomal subunit (GO:0015935)	12

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer