Unigene SGN-U209175

Unigene Basic Information 
Unigene ID: SGN-U209175
Unigene Build: Petunia hybrida #1
Date: 2004-03-30
Organism: P.hybrida
Alternative ID: 209175
mRNA sequence: Length: 569 bp

>SGN-U209175 Petunia hybrida #1 (1 members)
GCTAGTACCACGTGGTCAGGCAAGAGGTCTGACCTGGTTTATTCCGGCAGATGATCCAACCTTAATATCCAAGCAACAGTTGTTTGCTAG
AATTGTTGGTGGACTTGGGGGAAGAGCTGCAGAGGAAGTGATCTTTGGTGAACCAGAGGTGACCACCGGTGCTGCTAGTGATTTGCAGCA
GATCACTGGGTTGGCAAAACAGATGGTTGTCACTTTTGGAATGTCTGAAATTGGTCCTTGGTCACTCATGGATTCTTCTGCCCAAGGTGG
TGATGTTATCATGAGAATGATGGCCAGGAATTCCATGTCAGAAAAGCTTGCTGAAGATATTGATTATGCTGTGAAGAGTATATCAGACAG
TGCATATGAGATTGCTTTGAGCCAAATCAGGAGCAACCGTGAAGCAATTGATAAGATTGTTGAAGTCCTCGTTGAAAAGGAAACGATGAA
TGGAGATGAATTCCGTGCTATTCTCTCAGAATTTGTCGAAATTCCAGCTGAAAACCAGGTCCCTCCAACTGTGCCTACCCCAGCAACTGT
ATAGTAACCTTTACTGACCACTACTTTTA


[Blast] [AA Translation]
Associated Loci (1)  
Locus symbolLocus nameGene activity
CDC48 cell division-like proteincell division-like protein
Genomic locations (0)None
Library representation (1)  
mRNA member sequences (1)  
Alignment image suppressed for unigene with only one aligned EST SGN-E533574
[Show Image]
Markers Information (0)  
Expression Data (0)  
Annotations (manual: 0 | blast: 2 | go: 3 )  
Protein prediction analysis (2)  
Gene Family (6)  
Preceding Unigenes (0)None