Sol Genomics Network

Unigene SGN-U209380

Unigene Basic Information

Unigene ID:	SGN-U209380
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209380
mRNA sequence:	Length: 624 bp

>SGN-U209380 Petunia hybrida #1 (1 members)
AAGGAAATGAGGAAAGGTATTGATTTAGCAACGACTCTTGAACGTATAGAGAAGAACTTTGTCATTACTGATCCAAGGTTGCCTGATAAT
CCCATTATCTTTGCATCGGATAGTTTCTTGGAGTTGACAGAGTACAGCCGTGAAGAAATCTTGGGAAGAAACTGCAGGTTTCTTCAAGGA
CCAGAAACTGATCCAGCTACTGTGAAAAAAATCAGAAATGCAATTGATAATCAAACTGATGTCACTGTCCAGCTCATTAATTACACTAAG
ACTGGCAAAAAGTTCTGGAATTTGTTCCACCTGCAGCCTATGCGTGATCAGAAGGGAGAGGTACAGTACTTCATTGGAGTGCAACTAGAT
GGAAGCCAGCATGTAGAGCCGCTTCAAAATAGTATTCCCGAAGACAAGGCAACCGAGAGTGCAGTGCTGGTCAAAGAAACTGCTGGAAAC
ATTGATGAAGCAGTTCGAGAGCTTCCAGATGCCAATTCAAAACCAGAGGATTTGTGGAGAAATCATTCAAAAGTTGTTTACGCAAAGCCT
CACAGGAGGGACAGCCCATCTTGGAAAGCAATACAGAAGATTCTGGAGAGTGGAGAACCGATAGGCTTGAAGCATTTTAAGCCA

[Blast] [AA Translation]

Associated Loci (0)

None

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	Petunia-PP	all floral organs anthesis	1824	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E528521
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 5 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	2	Prot_kinase	1610
2	23588	PAS-assoc_C PAC PAS_domain	12
5	57436	PAS-assoc_C PAC PAS_domain Prot_kinase	13
1.1	101361	Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Protein kinase-like	1515
2	120374	PAS fold PAS - Molecular Function: signal transducer activity (GO:0004871) - Biological Process: signal transduction (GO:0007165) PAS-associated C-terminal - Molecular Function: two-component sensor activity (GO:0000155) - Biological Process: two-component signal transduction system (phosphorelay) (GO:0000160) PAC motif - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Biological Process: signal transduction (GO:0007165) PAS fold-3	9
5	131972	PAS fold Protein kinase-like PAS - Molecular Function: signal transducer activity (GO:0004871) - Biological Process: signal transduction (GO:0007165) PAS-associated C-terminal - Molecular Function: two-component sensor activity (GO:0000155) - Biological Process: two-component signal transduction system (phosphorelay) (GO:0000160) Protein kinase - Molecular Function: protein kinase activity (GO:0004672) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) PAC motif - Biological Process: regulation of transcription DNA-dependent (GO:0006355) - Biological Process: signal transduction (GO:0007165) Serine/threonine protein kinase - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Molecular Function: ATP binding (GO:0005524) - Biological Process: protein amino acid phosphorylation (GO:0006468) Serine/threonine protein kinase active site - Molecular Function: protein serine/threonine kinase activity (GO:0004674) - Biological Process: protein amino acid phosphorylation (GO:0006468)	6

*i value: controls inflation, a process to dissipate family clusters. At high i value, genes tend to be separated into different families.
**Annotation: the most common InterPro annotation(s) of the Arabidopsis members in the family.

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer