Sol Genomics Network

Unigene SGN-U209962

Unigene Basic Information

Unigene ID:	SGN-U209962
Unigene Build:	Petunia hybrida #1
Date:	2004-03-30
Organism:	P.hybrida
Alternative ID:	209962
mRNA sequence:	Length: 533 bp

>SGN-U209962 Petunia hybrida #1 (1 members)
ATTTGATCAAGTGCAATGGCGGCACCACCGGCAAGAGCAAGAGCAGATTATGATTACCTCATTAAACTCCTTTTAATCGGCGATAGCGGT
GTTGGTAAGAGTTGCCTTCTTTTACGGTTCTCTGATGGTTCCTTCACCACAAGCTTTATCACAACGATCGGAATTGATTTTAAAATTCGG
ACCATTGAGCTTGATGGAAAGAGGATCAAGCTTCAAATATGGGATACAGCTGGACAGGAACGGTTCAGGACTATCACTACTGCTTACTAT
CGTGGAGCAATGGGTATATTGTTGGTGTATGATGTTACTGACGAATCATCCTTTAACAACATTAGGAACTGGATTCGTAACATTGAGCAG
CATGCCTCTGACAATGTCAACAAAATACTTGTAGGAAACAAGGCTGACATGGATGAAAGCAAGAGGGCTGTTCCTACCGCAAAGGGCCAA
GCACTTGCAGATGAATACGGAATTAAGTTTTTTGAAACAAGTGCAAAGACAAATCTTAACGTGGAATCAGTTTTCTTCTCAAT

[Blast] [AA Translation]

Associated Loci (1)

Locus symbol	Locus name	Gene activity
PHU35026	Rab1-like small GTP-binding protein	Rab1-like small GTP-binding protein

Genomic locations (0)

None

Library representation (1)

Organism	Library	Description	Library size (#ESTs)	Ests in this Unigene
Petunia x hybrida	cPHA	stamens stamens from open flowers on 18-20 week old plants	6801	1

mRNA member sequences (1)

Alignment image suppressed for unigene with only one aligned EST SGN-E531487
[Show Image]

Markers Information (0)

Expression Data (0)

Annotations (manual: 0 | blast: 2 | go: 6 )

Protein prediction analysis (2)

Gene Family (6)

Family Build (I value*)	Family ID	Annotation**	# Members
1.2	14	Ras_trnsfrmng	471
2	21981	Ras_trnsfrmng	310
5	56261	Ras_trnsfrmng	245
1.1	101377	Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	504
2	118418	Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264)	280
5	128935	Small GTP-binding protein domain - Molecular Function: GTP binding (GO:0005525) Ras Ras GTPase - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) Ras small GTPase Rab type - Molecular Function: GTP binding (GO:0005525) - Biological Process: small GTPase mediated signal transduction (GO:0007264) - Biological Process: protein transport (GO:0015031)	203

Preceding Unigenes (0)

None

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

Attribute	Value
Project Name:
Start Date:
End Date:
Event Type:
Event Description:
Event Web URL:

SGN is supported by , and hosted at
Cite SGN using | Disclaimer